Incidental Mutation 'ANU22:Tedc1'
List |< first << previous [record 37 of 44] next >> last >|
ID262599
Institutional Source Beutler Lab
Gene Symbol Tedc1
Ensembl Gene ENSMUSG00000037466
Gene Nametubulin epsilon and delta complex 1
Synonyms4930427A07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU22
Quality Score178
Status Not validated
Chromosome12
Chromosomal Location113156421-113166048 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 113163188 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 357 (R357*)
Ref Sequence ENSEMBL: ENSMUSP00000035351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049271] [ENSMUST00000196755] [ENSMUST00000200522]
Predicted Effect probably null
Transcript: ENSMUST00000049271
AA Change: R357*
SMART Domains Protein: ENSMUSP00000035351
Gene: ENSMUSG00000037466
AA Change: R357*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DUF4509 41 221 4.8e-65 PFAM
low complexity region 233 245 N/A INTRINSIC
Pfam:DUF4510 258 418 3.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196755
SMART Domains Protein: ENSMUSP00000143431
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:DUF4509 40 138 4.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198072
Predicted Effect probably benign
Transcript: ENSMUST00000200522
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Tedc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tedc1 APN 12 113163150 missense probably damaging 0.97
IGL01074:Tedc1 APN 12 113163188 nonsense probably null
IGL01075:Tedc1 APN 12 113163188 nonsense probably null
IGL01077:Tedc1 APN 12 113163188 nonsense probably null
IGL01084:Tedc1 APN 12 113163188 nonsense probably null
IGL01103:Tedc1 APN 12 113163188 nonsense probably null
IGL01108:Tedc1 APN 12 113163188 nonsense probably null
IGL01137:Tedc1 APN 12 113163188 nonsense probably null
IGL01142:Tedc1 APN 12 113163188 nonsense probably null
IGL01149:Tedc1 APN 12 113163188 nonsense probably null
IGL01150:Tedc1 APN 12 113163188 nonsense probably null
IGL01151:Tedc1 APN 12 113163188 nonsense probably null
IGL02646:Tedc1 APN 12 113157301 missense possibly damaging 0.68
IGL02989:Tedc1 APN 12 113163321 missense probably benign 0.09
ANU05:Tedc1 UTSW 12 113163188 nonsense probably null
R1309:Tedc1 UTSW 12 113161780 missense probably benign
R1555:Tedc1 UTSW 12 113156497 unclassified probably benign
R2092:Tedc1 UTSW 12 113157720 missense probably damaging 1.00
R3053:Tedc1 UTSW 12 113156467 unclassified probably benign
R4130:Tedc1 UTSW 12 113163208 missense probably benign 0.01
R5050:Tedc1 UTSW 12 113156705 missense possibly damaging 0.86
R5386:Tedc1 UTSW 12 113156682 missense probably benign 0.03
R6377:Tedc1 UTSW 12 113161355 missense probably damaging 1.00
R6749:Tedc1 UTSW 12 113158082 missense probably damaging 1.00
R6761:Tedc1 UTSW 12 113161714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGCTCAAGAGCATCTGTACC -3'
(R):5'- AAACCTCTCAGGAGGACCAGACTG -3'

Sequencing Primer
(F):5'- AAGAGCATCTGTACCTTCTCTCAC -3'
(R):5'- CTCTGAGATCCTACACAGATGG -3'
Posted On2015-02-04