Incidental Mutation 'ANU22:Zfp148'
ID262609
Institutional Source Beutler Lab
Gene Symbol Zfp148
Ensembl Gene ENSMUSG00000022811
Gene Namezinc finger protein 148
SynonymsZBP-89, BFCOL1, BERF-1, beta enolase repressor factor 1, 2210405J08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33380836-33504363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33456943 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 134 (V134A)
Ref Sequence ENSEMBL: ENSMUSP00000126338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089677] [ENSMUST00000165418] [ENSMUST00000232023]
Predicted Effect probably benign
Transcript: ENSMUST00000089677
AA Change: V134A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087106
Gene: ENSMUSG00000022811
AA Change: V134A

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165418
AA Change: V134A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126338
Gene: ENSMUSG00000022811
AA Change: V134A

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232023
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel family of zinc finger DNA binding proteins. The encoded protein activates transcription of the T-cell receptor and intestinal alkaline phosphatase genes but represses transcription of the ornithine decarboxylase, vimentin, gastrin, stomelysin, and enolase genes. Increased expression of this gene results in decreased patient survival rates from colorectal cancer, while mutations in this gene have been associated with global developmental delay, hypoplastic corpus callosum, and dysmorphic facies. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption of one allele results in haploinsufficient male infertility in which chimeric males display a loss of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Zfp148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Zfp148 APN 16 33456943 missense probably benign
IGL02059:Zfp148 APN 16 33496563 missense probably damaging 1.00
IGL02389:Zfp148 APN 16 33495446 missense probably damaging 1.00
R0680:Zfp148 UTSW 16 33495804 missense possibly damaging 0.74
R1455:Zfp148 UTSW 16 33495465 critical splice donor site probably null
R2175:Zfp148 UTSW 16 33496746 nonsense probably null
R2497:Zfp148 UTSW 16 33496385 missense probably damaging 1.00
R4229:Zfp148 UTSW 16 33434763 missense probably benign 0.00
R4470:Zfp148 UTSW 16 33496232 missense probably damaging 0.98
R4687:Zfp148 UTSW 16 33496819 missense probably damaging 1.00
R4693:Zfp148 UTSW 16 33468135 missense probably damaging 1.00
R4701:Zfp148 UTSW 16 33456908 missense probably benign 0.00
R5272:Zfp148 UTSW 16 33496224 missense probably damaging 0.99
R5479:Zfp148 UTSW 16 33497219 missense probably damaging 0.99
R5511:Zfp148 UTSW 16 33434634 start gained probably benign
R5679:Zfp148 UTSW 16 33495786 missense probably damaging 1.00
R5798:Zfp148 UTSW 16 33496143 missense probably benign 0.03
R6142:Zfp148 UTSW 16 33495459 missense possibly damaging 0.63
R6368:Zfp148 UTSW 16 33497198 missense probably damaging 0.99
R6866:Zfp148 UTSW 16 33468126 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACAGTTCTCTCGCATCTGGC -3'
(R):5'- TACAGAAGTGGGCACAGCACAC -3'

Sequencing Primer
(F):5'- ATGGGCAATGTCCTAGCATC -3'
(R):5'- CCAACTACTGATCCACATTAAGAC -3'
Posted On2015-02-04