Incidental Mutation 'ANU22:Crybg3'
ID262610
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Namebeta-gamma crystallin domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59490775-59600979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59529227 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 934 (H934L)
Ref Sequence ENSEMBL: ENSMUSP00000037682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000172910]
Predicted Effect probably damaging
Transcript: ENSMUST00000044604
AA Change: H934L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723
AA Change: H934L

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129762
Predicted Effect probably damaging
Transcript: ENSMUST00000172910
AA Change: H2648L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000179383
AA Change: H934L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137452
Gene: ENSMUSG00000022723
AA Change: H934L

DomainStartEndE-ValueType
low complexity region 390 405 N/A INTRINSIC
low complexity region 414 422 N/A INTRINSIC
XTALbg 562 648 2.78e-4 SMART
Pfam:Crystall 668 731 1e-6 PFAM
XTALbg 746 831 1.2e-21 SMART
XTALbg 839 922 5.73e-19 SMART
XTALbg 935 1013 6.87e-5 SMART
XTALbg 1021 1101 1.28e-7 SMART
RICIN 1104 1236 8.16e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000232544
AA Change: H39L
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59565211 critical splice donor site probably null
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59544125 missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 unclassified probably null
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59560095 unclassified probably benign
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59559166 missense probably benign 0.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6042:Crybg3 UTSW 16 59550475 missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense not run
R7133:Crybg3 UTSW 16 59536804 missense not run
Predicted Primers PCR Primer
(F):5'- GTCTATAATAAGCACCGCAGGCCAG -3'
(R):5'- CGTGTGGTAATGAGAATCACCGCAG -3'

Sequencing Primer
(F):5'- GGATGCTGTGACACATCCAG -3'
(R):5'- GGCCCTTTCTAAAATGTACCCAG -3'
Posted On2015-02-04