Incidental Mutation 'ANU22:Wtap'
ID262611
Institutional Source Beutler Lab
Gene Symbol Wtap
Ensembl Gene ENSMUSG00000060475
Gene NameWilms tumour 1-associating protein
Synonyms9430038B09Rik, 2810408K05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12966796-12992546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12967895 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 255 (T255K)
Ref Sequence ENSEMBL: ENSMUSP00000124205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007007] [ENSMUST00000159551] [ENSMUST00000159986]
Predicted Effect probably benign
Transcript: ENSMUST00000007007
AA Change: T255K

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000007007
Gene: ENSMUSG00000060475
AA Change: T255K

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
coiled coil region 177 248 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159551
AA Change: T255K

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124205
Gene: ENSMUSG00000060475
AA Change: T255K

DomainStartEndE-ValueType
Pfam:Wtap 1 248 2.8e-157 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159986
SMART Domains Protein: ENSMUSP00000123961
Gene: ENSMUSG00000060475

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160654
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a mutation display lethality during embryogenesis with abnormalities appearing during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in Wtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wtap APN 17 12967895 missense probably benign 0.08
IGL01867:Wtap APN 17 12969455 missense probably benign 0.00
IGL02379:Wtap APN 17 12969449 missense probably benign
IGL02437:Wtap APN 17 12967733 missense probably benign
IGL02975:Wtap APN 17 12983511 missense possibly damaging 0.85
R1457:Wtap UTSW 17 12981744 splice site probably null
R1799:Wtap UTSW 17 12980884 missense possibly damaging 0.96
R2240:Wtap UTSW 17 12975465 nonsense probably null
R2328:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R2332:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R3426:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R4382:Wtap UTSW 17 12975420 missense probably damaging 0.99
R4703:Wtap UTSW 17 12980824 missense probably benign 0.23
R4879:Wtap UTSW 17 12969435 missense probably damaging 0.99
R4956:Wtap UTSW 17 12967536 missense probably benign 0.06
R5044:Wtap UTSW 17 12967638 missense possibly damaging 0.47
R6366:Wtap UTSW 17 12968058 splice site probably null
R6813:Wtap UTSW 17 12967510 missense probably damaging 0.96
T0970:Wtap UTSW 17 12969390 unclassified probably benign
X0067:Wtap UTSW 17 12985929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCCGCACTGAGTGGGTTTATG -3'
(R):5'- TGGCTCTCCTTTGCACAGAACTG -3'

Sequencing Primer
(F):5'- AGTGGGTTTATGTAACTACTACCTCC -3'
(R):5'- CCTTTGCACAGAACTGAATGACTTC -3'
Posted On2015-02-04