Incidental Mutation 'ANU22:St8sia5'
ID262617
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77254662 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 320 (G320D)
Ref Sequence ENSEMBL: ENSMUSP00000078566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect probably damaging
Transcript: ENSMUST00000075290
AA Change: G356D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: G356D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079618
AA Change: G320D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: G320D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Zfp397 C T 18: 23,960,751 S431L probably damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCGTTCTACAACGTCCGCAAC -3'
(R):5'- ATGGCAAGGTCAAGGAATCCTTCAG -3'

Sequencing Primer
(F):5'- CTTCCGAGTCAAATACATGCTGG -3'
(R):5'- GGCCTGGTTTTCAGCAGC -3'
Posted On2015-02-04