Incidental Mutation 'ANU74:Rbms1'
ID262675
Institutional Source Beutler Lab
Gene Symbol Rbms1
Ensembl Gene ENSMUSG00000026970
Gene NameRNA binding motif, single stranded interacting protein 1
SynonymsMSSP-1, 2600014B10Rik, YC1, MSSP-2, MSSP-3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU74
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location60750193-60963192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60797716 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 60 (A60E)
Ref Sequence ENSEMBL: ENSMUSP00000108128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028347] [ENSMUST00000112509] [ENSMUST00000164147]
Predicted Effect probably damaging
Transcript: ENSMUST00000028347
AA Change: A93E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028347
Gene: ENSMUSG00000026970
AA Change: A93E

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
RRM 63 131 4.56e-18 SMART
RRM 142 213 2.43e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112509
AA Change: A60E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108128
Gene: ENSMUSG00000026970
AA Change: A60E

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
RRM 30 98 4.56e-18 SMART
RRM 109 180 2.43e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164147
AA Change: A91E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131306
Gene: ENSMUSG00000026970
AA Change: A91E

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
RRM 61 129 4.56e-18 SMART
RRM 140 211 2.43e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. Several transcript variants, resulting from alternative splicing and encoding different isoforms, have been described. A pseudogene for this locus is found on chromosome 12. [provided by RefSeq, Feb 2009]
PHENOTYPE: Only about half the expected number of mice homozygous for disruptions in this gene are produced in matings of heterozygotes. Embryo sizes are reduced. Females have smaller than normal uteri and decreased levels of progesterone during estrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 49,961,038 S1056L probably benign Het
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Chrd T A 16: 20,741,319 M912K possibly damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Csf1r A G 18: 61,117,391 E431G probably benign Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Hecw2 T C 1: 53,925,694 T658A probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Irf8 A C 8: 120,739,869 I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Sec61b C A 4: 47,474,922 N26K possibly damaging Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Sspo G A 6: 48,460,959 G1351S probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Rbms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Rbms1 APN 2 60797705 missense probably damaging 1.00
IGL01131:Rbms1 APN 2 60758836 missense probably benign 0.00
IGL02565:Rbms1 APN 2 60759779 missense probably benign
IGL02662:Rbms1 APN 2 60762306 missense probably damaging 1.00
R0077:Rbms1 UTSW 2 60758835 missense possibly damaging 0.48
R0279:Rbms1 UTSW 2 60842410 missense probably damaging 0.99
R0718:Rbms1 UTSW 2 60842412 missense probably damaging 0.99
R1582:Rbms1 UTSW 2 60758835 missense possibly damaging 0.48
R2151:Rbms1 UTSW 2 60762048 splice site probably null
R4812:Rbms1 UTSW 2 60792769 missense possibly damaging 0.74
R5109:Rbms1 UTSW 2 60781940 missense probably damaging 1.00
R6925:Rbms1 UTSW 2 60762304 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTCCAATGGTCTTCAGTAAGCAGC -3'
(R):5'- CGCCTTGTGTTTCCCCTCAGTAAAG -3'

Sequencing Primer
(F):5'- GGTCTTCAGTAAGCAGCTCTAATC -3'
(R):5'- GTTTCCCCTCAGTAAAGAACATTTTG -3'
Posted On2015-02-04