Incidental Mutation 'ANU74:Sec61b'
ID262686
Institutional Source Beutler Lab
Gene Symbol Sec61b
Ensembl Gene ENSMUSG00000053317
Gene NameSec61 beta subunit
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #ANU74
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location47474658-47483242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47474922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 26 (N26K)
Ref Sequence ENSEMBL: ENSMUSP00000120880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044148] [ENSMUST00000065678] [ENSMUST00000125622] [ENSMUST00000137461]
Predicted Effect probably benign
Transcript: ENSMUST00000044148
SMART Domains Protein: ENSMUSP00000043580
Gene: ENSMUSG00000039740

DomainStartEndE-ValueType
Pfam:Glyco_transf_4 21 208 1.1e-10 PFAM
Pfam:Glyco_trans_4_4 27 189 1.3e-12 PFAM
Pfam:Glycos_transf_1 211 393 4.1e-37 PFAM
Pfam:Glyco_trans_1_4 224 379 1.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065678
AA Change: T5K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000067681
Gene: ENSMUSG00000053317
AA Change: T5K

DomainStartEndE-ValueType
Pfam:Sec61_beta 51 91 1.5e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125622
AA Change: N14K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136912
Predicted Effect possibly damaging
Transcript: ENSMUST00000137461
AA Change: N26K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000143104
SMART Domains Protein: ENSMUSP00000121934
Gene: ENSMUSG00000039740

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glycos_transf_1 84 177 6.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the beta-subunit protein. The Sec61 subunits are also observed in the post-ER compartment, suggesting that these proteins can escape the ER and recycle back. There is evidence for multiple polyadenylated sites for this transcript. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 49,961,038 S1056L probably benign Het
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Chrd T A 16: 20,741,319 M912K possibly damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Csf1r A G 18: 61,117,391 E431G probably benign Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Hecw2 T C 1: 53,925,694 T658A probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Irf8 A C 8: 120,739,869 I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Rbms1 G T 2: 60,797,716 A60E probably damaging Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Sspo G A 6: 48,460,959 G1351S probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Sec61b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1761:Sec61b UTSW 4 47480137 missense possibly damaging 0.83
R4940:Sec61b UTSW 4 47483074 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGCTCGGCAACTTCACGACTTC -3'
(R):5'- ACTCCTCCTTCCAGCAATGCAATG -3'

Sequencing Primer
(F):5'- CGTTCTTAGGCATCAGCATGG -3'
(R):5'- GCAATGCAATGCAACCCTG -3'
Posted On2015-02-04