Incidental Mutation 'ANU74:Adgra3'
ID262689
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Nameadhesion G protein-coupled receptor A3
SynonymsGpr125, Tem5-like, 3830613O22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #ANU74
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location49959956-50059006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49961038 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1056 (S1056L)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
Predicted Effect probably benign
Transcript: ENSMUST00000030971
AA Change: S1056L

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: S1056L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Chrd T A 16: 20,741,319 M912K possibly damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Csf1r A G 18: 61,117,391 E431G probably benign Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Hecw2 T C 1: 53,925,694 T658A probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Irf8 A C 8: 120,739,869 I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Rbms1 G T 2: 60,797,716 A60E probably damaging Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Sec61b C A 4: 47,474,922 N26K possibly damaging Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Sspo G A 6: 48,460,959 G1351S probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0831:Adgra3 UTSW 5 49970802 missense probably damaging 1.00
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3086:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4667:Adgra3 UTSW 5 49978956 missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
R7026:Adgra3 UTSW 5 49960741 missense probably benign
R7147:Adgra3 UTSW 5 49961245 missense probably damaging 1.00
R7206:Adgra3 UTSW 5 50006896 missense probably damaging 1.00
R7381:Adgra3 UTSW 5 50058774 start codon destroyed probably null
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCATTCACAGGTAGGGCATTG -3'
(R):5'- ACGAGCACAGTTTTCAGTCTCAGC -3'

Sequencing Primer
(F):5'- ACAGGTAGGGCATTGCTGTG -3'
(R):5'- AGTCTCAGCTTCTGGGCG -3'
Posted On2015-02-04