Incidental Mutation 'ANU74:Chrd'
ID262726
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Namechordin
SynonymsChd
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #ANU74
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20733127-20742384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20741319 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 912 (M912K)
Ref Sequence ENSEMBL: ENSMUSP00000156080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000115423] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000232646]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007171
AA Change: M890K

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: M890K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083438
Predicted Effect probably benign
Transcript: ENSMUST00000115423
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect probably benign
Transcript: ENSMUST00000231698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Predicted Effect possibly damaging
Transcript: ENSMUST00000232646
AA Change: M912K

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 49,961,038 S1056L probably benign Het
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Csf1r A G 18: 61,117,391 E431G probably benign Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Hecw2 T C 1: 53,925,694 T658A probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Irf8 A C 8: 120,739,869 I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Rbms1 G T 2: 60,797,716 A60E probably damaging Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Sec61b C A 4: 47,474,922 N26K possibly damaging Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Sspo G A 6: 48,460,959 G1351S probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20741225 missense possibly damaging 0.89
IGL01486:Chrd APN 16 20734140 splice site probably null
IGL02120:Chrd APN 16 20734541 missense probably damaging 1.00
IGL02370:Chrd APN 16 20735791 missense possibly damaging 0.52
IGL02675:Chrd APN 16 20739949 splice site probably benign
IGL02678:Chrd APN 16 20734020 missense probably damaging 1.00
IGL02874:Chrd APN 16 20735196 missense probably damaging 1.00
PIT1430001:Chrd UTSW 16 20738998 critical splice donor site probably null
R0016:Chrd UTSW 16 20734308 missense possibly damaging 0.85
R0230:Chrd UTSW 16 20733275 missense probably benign 0.25
R0605:Chrd UTSW 16 20735439 missense probably damaging 1.00
R0831:Chrd UTSW 16 20741309 missense probably damaging 0.99
R1501:Chrd UTSW 16 20737533 missense probably damaging 1.00
R1659:Chrd UTSW 16 20735831 missense probably damaging 0.96
R1766:Chrd UTSW 16 20737441 missense probably damaging 1.00
R1823:Chrd UTSW 16 20741347 splice site probably benign
R3001:Chrd UTSW 16 20737445 nonsense probably null
R3002:Chrd UTSW 16 20737445 nonsense probably null
R3874:Chrd UTSW 16 20738910 missense probably damaging 0.99
R4319:Chrd UTSW 16 20737048 missense probably damaging 0.99
R4587:Chrd UTSW 16 20738575 missense possibly damaging 0.58
R4707:Chrd UTSW 16 20738808 missense possibly damaging 0.58
R4857:Chrd UTSW 16 20738758 missense possibly damaging 0.79
R5204:Chrd UTSW 16 20736072 missense probably benign 0.02
R5364:Chrd UTSW 16 20733148 start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20738910 missense possibly damaging 0.74
R5611:Chrd UTSW 16 20738974 missense probably damaging 1.00
R5940:Chrd UTSW 16 20734586 missense probably null 0.01
R6004:Chrd UTSW 16 20735237 missense possibly damaging 0.92
R6767:Chrd UTSW 16 20738626 missense probably benign 0.00
R6798:Chrd UTSW 16 20734306 missense probably damaging 1.00
R6801:Chrd UTSW 16 20735747 missense possibly damaging 0.68
R6823:Chrd UTSW 16 20734736 missense probably damaging 1.00
R6999:Chrd UTSW 16 20735652 missense probably benign
R7069:Chrd UTSW 16 20739433 missense probably damaging 1.00
R7136:Chrd UTSW 16 20734522 missense possibly damaging 0.82
X0063:Chrd UTSW 16 20737564 critical splice donor site probably null
Z1088:Chrd UTSW 16 20741255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGAACCAGAAACTACTAGGCTAGGG -3'
(R):5'- TGCAGTGGGAACAGCATCGAC -3'

Sequencing Primer
(F):5'- CTACTAGGCTAGGGGAATTCAAAG -3'
(R):5'- TTCCCTGAGCCACAGGATAG -3'
Posted On2015-02-04