Incidental Mutation 'ANU74:Csf1r'
ID262733
Institutional Source Beutler Lab
Gene Symbol Csf1r
Ensembl Gene ENSMUSG00000024621
Gene Namecolony stimulating factor 1 receptor
SynonymsFms, Fim-2, CD115, M-CSFR, CSF-1R, Csfmr
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #ANU74
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61105572-61132149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61117391 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 431 (E431G)
Ref Sequence ENSEMBL: ENSMUSP00000110923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000115268]
PDB Structure
Structure of M-CSF bound to the first three domains of FMS [X-RAY DIFFRACTION]
Structure of mouse Interleukin-34 in complex with mouse FMS [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025523
AA Change: E431G

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: E431G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115268
AA Change: E431G

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: E431G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183458
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 G A 5: 49,961,038 S1056L probably benign Het
Ankrd26 A T 6: 118,552,775 D236E probably benign Het
Capn15 C T 17: 25,965,486 W7* probably null Het
Celsr2 G A 3: 108,412,499 T999M probably damaging Het
Chrd T A 16: 20,741,319 M912K possibly damaging Het
Col9a1 A G 1: 24,185,328 D197G unknown Het
Eloc A G 1: 16,643,350 F115L possibly damaging Het
Fap T C 2: 62,547,769 D193G probably damaging Het
Fscn2 T C 11: 120,362,336 Y210H probably damaging Het
Fut9 G C 4: 25,620,802 T4R probably benign Het
Grb2 A T 11: 115,645,907 D131E probably benign Het
Hecw2 T C 1: 53,925,694 T658A probably benign Het
Helz2 T C 2: 181,234,834 E1289G probably benign Het
Hyou1 A G 9: 44,381,263 N92D possibly damaging Het
Irf8 A C 8: 120,739,869 I18L possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif12 GC "GCCTCCACCCGGCGGTC,GCC" 4: 63,171,426 probably null Het
Lamc2 A C 1: 153,131,835 D864E probably benign Het
Map3k4 A G 17: 12,232,976 V1475A probably damaging Het
Mapk8ip3 A C 17: 24,900,577 M1030R possibly damaging Het
Mat1a A G 14: 41,111,142 D94G probably benign Het
Myh15 T A 16: 49,172,932 D1643E possibly damaging Het
Myo15b T C 11: 115,878,413 F55L probably damaging Het
Nhlh2 A T 3: 102,012,654 M1L probably benign Het
Nup214 T C 2: 32,034,966 S1836P probably damaging Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olr1 G A 6: 129,500,069 R78C possibly damaging Het
Pam16 C A 16: 4,616,633 V98F probably damaging Het
Pelp1 C T 11: 70,395,087 V652I probably damaging Het
Pole A G 5: 110,289,370 H67R probably benign Het
Rbms1 G T 2: 60,797,716 A60E probably damaging Het
Recql4 A T 15: 76,705,757 M789K possibly damaging Het
Rrn3 T C 16: 13,811,533 F571S possibly damaging Het
Ryr3 T C 2: 112,831,230 probably null Het
Sec61b C A 4: 47,474,922 N26K possibly damaging Het
Serinc1 T C 10: 57,519,842 E284G probably benign Het
Slc30a9 G A 5: 67,349,852 D496N probably damaging Het
Slc44a4 G A 17: 34,921,578 R249H probably damaging Het
Slc6a13 A C 6: 121,334,876 D404A probably benign Het
Spata18 A G 5: 73,671,113 E225G probably damaging Het
Sspo G A 6: 48,460,959 G1351S probably damaging Het
Tgm3 T C 2: 130,048,390 V691A probably damaging Het
Tns3 C T 11: 8,492,149 R738Q probably benign Het
Tyk2 A T 9: 21,116,158 I506N probably damaging Het
Ube2v1 G A 2: 167,610,344 T113I probably damaging Het
Vmn1r177 A G 7: 23,866,220 V77A possibly damaging Het
Vmn2r14 A T 5: 109,219,044 S437T probably benign Het
Vmn2r78 G C 7: 86,921,065 V264L possibly damaging Het
Zfp956 T G 6: 47,963,573 Y289D probably benign Het
Other mutations in Csf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Csf1r APN 18 61114825 missense probably benign 0.08
IGL01603:Csf1r APN 18 61129301 missense probably damaging 1.00
IGL02377:Csf1r APN 18 61124468 splice site probably benign
IGL03000:Csf1r APN 18 61109652 missense probably damaging 0.97
IGL03011:Csf1r APN 18 61110401 missense probably benign 0.00
IGL03132:Csf1r APN 18 61128099 missense probably benign 0.03
IGL03189:Csf1r APN 18 61105986 missense probably benign 0.05
IGL03224:Csf1r APN 18 61112062 missense probably damaging 0.96
IGL03351:Csf1r APN 18 61117108 nonsense probably null
R1245:Csf1r UTSW 18 61114812 missense probably benign
R1363:Csf1r UTSW 18 61124845 missense possibly damaging 0.95
R1651:Csf1r UTSW 18 61110401 missense possibly damaging 0.64
R1785:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1786:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1902:Csf1r UTSW 18 61130141 missense probably damaging 0.99
R1968:Csf1r UTSW 18 61112795 missense probably benign 0.00
R2177:Csf1r UTSW 18 61114943 splice site probably benign
R3743:Csf1r UTSW 18 61114774 missense probably benign 0.01
R3809:Csf1r UTSW 18 61112764 missense probably benign 0.22
R4374:Csf1r UTSW 18 61119006 missense probably damaging 0.99
R4683:Csf1r UTSW 18 61124911 missense probably damaging 1.00
R4973:Csf1r UTSW 18 61129047 missense probably damaging 1.00
R5080:Csf1r UTSW 18 61124301 missense probably damaging 1.00
R5314:Csf1r UTSW 18 61129724 missense probably damaging 1.00
R5936:Csf1r UTSW 18 61125808 missense probably damaging 1.00
R6015:Csf1r UTSW 18 61109712 missense possibly damaging 0.50
R6227:Csf1r UTSW 18 61125828 nonsense probably null
R6505:Csf1r UTSW 18 61129733 missense probably damaging 1.00
R6602:Csf1r UTSW 18 61110425 missense possibly damaging 0.81
R6811:Csf1r UTSW 18 61119053 missense probably damaging 1.00
R6813:Csf1r UTSW 18 61112734 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGGCAGGCTGGAATAATCTGAC -3'
(R):5'- GGGCTTCATCACACCTGGAACAAC -3'

Sequencing Primer
(F):5'- CAGGCTGGAATAATCTGACCTTTG -3'
(R):5'- GAACAACAGACTTTGATTCAGGC -3'
Posted On2015-02-04