Incidental Mutation 'R3087:Ces2e'
ID262867
Institutional Source Beutler Lab
Gene Symbol Ces2e
Ensembl Gene ENSMUSG00000031886
Gene Namecarboxylesterase 2E
Synonyms9030624L02Rik, Ces5
MMRRC Submission 040576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R3087 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104926260-104934672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104930715 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 289 (M289K)
Ref Sequence ENSEMBL: ENSMUSP00000105037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034355] [ENSMUST00000109410]
Predicted Effect probably benign
Transcript: ENSMUST00000034355
AA Change: M289K

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886
AA Change: M289K

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109410
AA Change: M289K

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105037
Gene: ENSMUSG00000031886
AA Change: M289K

DomainStartEndE-ValueType
Pfam:COesterase 9 538 1.7e-171 PFAM
Pfam:Abhydrolase_3 143 246 6.6e-11 PFAM
Pfam:Peptidase_S9 158 276 2.1e-7 PFAM
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aknad1 C T 3: 108,756,863 Q381* probably null Het
Arhgef39 C T 4: 43,497,581 probably null Het
Ccdc85a G T 11: 28,392,857 C113* probably null Het
Cdc16 T C 8: 13,759,004 Y19H probably damaging Het
Cyp2u1 G A 3: 131,303,027 A34V probably benign Het
Dkk2 A C 3: 132,086,139 N36T probably damaging Het
Fam222a A G 5: 114,611,954 S404G probably damaging Het
Fbll1 A T 11: 35,798,190 V82E probably damaging Het
Flt3 A G 5: 147,348,046 S754P probably benign Het
Fmo5 T C 3: 97,641,695 W220R probably damaging Het
Gif A T 19: 11,760,373 K383* probably null Het
Gm13023 A G 4: 143,793,846 D56G probably benign Het
Gm7275 A G 16: 48,073,735 noncoding transcript Het
Gmeb2 G T 2: 181,255,640 probably benign Het
Ifi44l T C 3: 151,762,857 H12R unknown Het
Itsn2 T C 12: 4,666,303 Y1021H probably damaging Het
Map4 T C 9: 110,053,189 S374P possibly damaging Het
Map4k4 A T 1: 40,021,082 probably null Het
Mast4 G T 13: 102,853,926 probably benign Het
Mdfic T A 6: 15,799,669 L265H probably damaging Het
Pabpc2 A G 18: 39,774,266 I195V probably benign Het
Prdm1 T C 10: 44,446,827 Y224C probably damaging Het
Spidr T C 16: 15,968,619 Y420C probably damaging Het
Tlr6 A T 5: 64,954,325 M413K probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn1r11 A C 6: 57,137,706 K81N possibly damaging Het
Vmn2r107 G A 17: 20,360,345 E515K probably benign Het
Vstm4 T C 14: 32,892,635 V178A possibly damaging Het
Other mutations in Ces2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Ces2e APN 8 104929565 missense probably benign 0.42
IGL02045:Ces2e APN 8 104930658 splice site probably benign
IGL02656:Ces2e APN 8 104927056 missense possibly damaging 0.94
IGL02904:Ces2e APN 8 104931338 missense probably benign
IGL02972:Ces2e APN 8 104927061 missense probably damaging 1.00
IGL03244:Ces2e APN 8 104928819 missense probably benign 0.38
R0585:Ces2e UTSW 8 104929821 missense probably damaging 1.00
R0762:Ces2e UTSW 8 104929864 missense probably damaging 0.98
R1004:Ces2e UTSW 8 104929738 missense probably damaging 1.00
R1168:Ces2e UTSW 8 104927014 missense possibly damaging 0.49
R1731:Ces2e UTSW 8 104929576 missense probably damaging 1.00
R2134:Ces2e UTSW 8 104932539 critical splice donor site probably null
R3693:Ces2e UTSW 8 104928811 missense probably damaging 1.00
R4622:Ces2e UTSW 8 104928709 intron probably null
R4873:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4875:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4965:Ces2e UTSW 8 104933698 missense probably benign 0.09
R5365:Ces2e UTSW 8 104927214 critical splice donor site probably null
R5529:Ces2e UTSW 8 104929911 missense probably benign 0.00
R5601:Ces2e UTSW 8 104929494 missense probably benign 0.42
R5968:Ces2e UTSW 8 104932995 missense probably damaging 1.00
R6128:Ces2e UTSW 8 104928796 missense probably benign 0.03
Z1088:Ces2e UTSW 8 104931347 missense probably benign
Z1088:Ces2e UTSW 8 104932398 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCACAATTGAGCAACAGGG -3'
(R):5'- TTGTCCCCAAAGAGACCTTAC -3'

Sequencing Primer
(F):5'- CAGGGAAATGGGAATAATTTTGTTC -3'
(R):5'- GTCCCCAAAGAGACCTTACTTTTAG -3'
Posted On2015-02-05