Incidental Mutation 'R3103:Olfr50'
ID262882
Institutional Source Beutler Lab
Gene Symbol Olfr50
Ensembl Gene ENSMUSG00000111021
Gene Nameolfactory receptor 50
SynonymsGA_x6K02T2NLDC-33487752-33488690, ID3, MOR136-6
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36790538-36797392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36793562 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 109 (C109R)
Ref Sequence ENSEMBL: ENSMUSP00000149484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072114] [ENSMUST00000112950] [ENSMUST00000213498] [ENSMUST00000214909] [ENSMUST00000215199] [ENSMUST00000216753] [ENSMUST00000217041]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072114
AA Change: C109R

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071985
Gene: ENSMUSG00000068950
AA Change: C109R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-8 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112950
AA Change: C109R

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108572
Gene: ENSMUSG00000111021
AA Change: C109R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 3.5e-34 PFAM
Pfam:7tm_4 140 284 3.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213498
Predicted Effect probably benign
Transcript: ENSMUST00000214909
Predicted Effect probably benign
Transcript: ENSMUST00000215199
Predicted Effect possibly damaging
Transcript: ENSMUST00000216753
AA Change: C109R

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217041
AA Change: C109R

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Olfr50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr50 APN 2 36794000 missense probably benign 0.05
IGL02316:Olfr50 APN 2 36793620 missense probably damaging 0.98
IGL02330:Olfr50 APN 2 36793895 missense probably benign 0.00
IGL03144:Olfr50 APN 2 36794081 missense probably benign 0.44
R0092:Olfr50 UTSW 2 36793496 missense probably benign 0.06
R0113:Olfr50 UTSW 2 36793994 missense probably damaging 0.98
R0113:Olfr50 UTSW 2 36793995 missense probably damaging 0.99
R0604:Olfr50 UTSW 2 36794107 nonsense probably null
R0932:Olfr50 UTSW 2 36793891 nonsense probably null
R1191:Olfr50 UTSW 2 36793338 missense probably damaging 0.97
R1238:Olfr50 UTSW 2 36793589 missense probably damaging 1.00
R1525:Olfr50 UTSW 2 36794143 missense probably null 0.01
R3955:Olfr50 UTSW 2 36793553 missense probably benign 0.34
R4573:Olfr50 UTSW 2 36793479 missense probably damaging 1.00
R5256:Olfr50 UTSW 2 36793673 missense probably benign
R5650:Olfr50 UTSW 2 36793265 missense probably benign 0.36
R6130:Olfr50 UTSW 2 36794043 missense probably benign 0.01
R6175:Olfr50 UTSW 2 36793968 missense probably damaging 1.00
R6320:Olfr50 UTSW 2 36793573 missense possibly damaging 0.90
R6481:Olfr50 UTSW 2 36793777 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTAGGCTGGACTCTCACCTC -3'
(R):5'- TTCAGCAAAGCAGAGAGATCAC -3'

Sequencing Primer
(F):5'- GCTGGACTCTCACCTCCACAC -3'
(R):5'- TCTCTAAAAAGAGAGAGACGAGC -3'
Posted On2015-02-05