Incidental Mutation 'R3103:Cep128'
ID262918
Institutional Source Beutler Lab
Gene Symbol Cep128
Ensembl Gene ENSMUSG00000061533
Gene Namecentrosomal protein 128
Synonyms4930534B04Rik, 5430424K18Rik
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R3103 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location90998492-91384409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91019344 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1006 (D1006V)
Ref Sequence ENSEMBL: ENSMUSP00000115679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141429] [ENSMUST00000143415]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133329
Predicted Effect probably damaging
Transcript: ENSMUST00000141429
AA Change: D1006V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115679
Gene: ENSMUSG00000061533
AA Change: D1006V

DomainStartEndE-ValueType
low complexity region 89 110 N/A INTRINSIC
coiled coil region 216 329 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
coiled coil region 377 822 N/A INTRINSIC
coiled coil region 876 960 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143415
AA Change: D553V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122627
Gene: ENSMUSG00000061533
AA Change: D553V

DomainStartEndE-ValueType
coiled coil region 2 369 N/A INTRINSIC
coiled coil region 423 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154836
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Klf17 T A 4: 117,760,608 Q184L possibly damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Cep128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cep128 APN 12 91234191 missense probably benign 0.17
IGL00800:Cep128 APN 12 91255664 missense possibly damaging 0.83
IGL01738:Cep128 APN 12 91230842 missense probably damaging 1.00
IGL01844:Cep128 APN 12 91008854 missense probably benign 0.14
IGL01918:Cep128 APN 12 91234210 missense probably damaging 0.99
IGL02043:Cep128 APN 12 91266730 splice site probably benign
IGL02405:Cep128 APN 12 91266986 missense probably benign 0.04
IGL02616:Cep128 APN 12 91296258 missense probably benign 0.03
R0416:Cep128 UTSW 12 91230867 splice site probably benign
R0442:Cep128 UTSW 12 91266771 missense probably damaging 1.00
R0608:Cep128 UTSW 12 90999535 utr 3 prime probably benign
R1108:Cep128 UTSW 12 91339109 missense probably damaging 1.00
R1178:Cep128 UTSW 12 91260155 missense probably damaging 1.00
R1183:Cep128 UTSW 12 91325598 missense possibly damaging 0.84
R1394:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1395:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1498:Cep128 UTSW 12 91366417 missense probably benign
R1541:Cep128 UTSW 12 91348781 missense probably damaging 1.00
R1639:Cep128 UTSW 12 91366368 missense probably damaging 1.00
R1643:Cep128 UTSW 12 91325532 missense probably damaging 1.00
R1682:Cep128 UTSW 12 91230822 missense probably damaging 0.99
R1739:Cep128 UTSW 12 91022491 splice site probably null
R1758:Cep128 UTSW 12 91347578 missense probably benign 0.02
R1845:Cep128 UTSW 12 91289598 missense probably benign 0.01
R1987:Cep128 UTSW 12 91230829 missense probably benign 0.01
R2017:Cep128 UTSW 12 91366464 missense probably damaging 0.98
R2237:Cep128 UTSW 12 91347567 missense probably benign 0.01
R2239:Cep128 UTSW 12 91347567 missense probably benign 0.01
R4552:Cep128 UTSW 12 91294162 missense probably damaging 0.98
R4664:Cep128 UTSW 12 91296253 missense probably damaging 1.00
R4774:Cep128 UTSW 12 91234195 missense probably damaging 0.99
R4838:Cep128 UTSW 12 90999545 utr 3 prime probably benign
R4858:Cep128 UTSW 12 91260162 missense probably benign 0.04
R4924:Cep128 UTSW 12 91022400 splice site silent
R5002:Cep128 UTSW 12 91255723 intron probably null
R5282:Cep128 UTSW 12 91339119 missense probably damaging 1.00
R5386:Cep128 UTSW 12 90999571 missense probably benign 0.03
R5476:Cep128 UTSW 12 91213618 missense probably damaging 0.96
R5643:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5644:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5668:Cep128 UTSW 12 90999636 missense probably benign 0.01
R6057:Cep128 UTSW 12 91296224 missense possibly damaging 0.92
R6831:Cep128 UTSW 12 91266974 missense probably damaging 0.99
R6852:Cep128 UTSW 12 91366342 critical splice donor site probably null
R7078:Cep128 UTSW 12 91234104 missense not run
R7144:Cep128 UTSW 12 91294159 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTTCCCAAGCATGCCAGC -3'
(R):5'- AGTGCAGCAGTTACCTTCCC -3'

Sequencing Primer
(F):5'- GCATGCCAGCACAAACACTG -3'
(R):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
Posted On2015-02-05