Incidental Mutation 'R3104:Sars'
ID262943
Institutional Source Beutler Lab
Gene Symbol Sars
Ensembl Gene ENSMUSG00000068739
Gene Nameseryl-aminoacyl-tRNA synthetase
SynonymsStrs
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108424865-108445209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108429305 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 302 (R302H)
Ref Sequence ENSEMBL: ENSMUSP00000099685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090553] [ENSMUST00000102625] [ENSMUST00000132467] [ENSMUST00000153499]
Predicted Effect probably damaging
Transcript: ENSMUST00000090553
AA Change: R302H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088041
Gene: ENSMUSG00000068739
AA Change: R302H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-20 PFAM
Pfam:tRNA-synt_2b 203 386 4.1e-39 PFAM
low complexity region 481 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102625
AA Change: R302H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099685
Gene: ENSMUSG00000068739
AA Change: R302H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.3e-22 PFAM
Pfam:tRNA-synt_2b 248 427 2.1e-41 PFAM
low complexity region 505 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132467
AA Change: R254H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120879
Gene: ENSMUSG00000068739
AA Change: R254H

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 6.1e-23 PFAM
Pfam:tRNA-synt_2b 155 338 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153499
SMART Domains Protein: ENSMUSP00000118676
Gene: ENSMUSG00000068739

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-23 PFAM
PDB:3VBB|F 150 187 3e-18 PDB
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Sars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Sars APN 3 108426858 missense probably damaging 0.99
IGL02898:Sars APN 3 108429263 missense probably damaging 1.00
R0660:Sars UTSW 3 108431473 missense probably damaging 1.00
R0749:Sars UTSW 3 108428266 missense possibly damaging 0.95
R0855:Sars UTSW 3 108426932 missense probably benign 0.07
R1249:Sars UTSW 3 108435935 missense probably benign 0.14
R1540:Sars UTSW 3 108433145 missense probably benign 0.01
R1659:Sars UTSW 3 108429416 missense probably damaging 1.00
R1836:Sars UTSW 3 108435944 missense probably benign 0.00
R2120:Sars UTSW 3 108434156 missense probably benign 0.00
R3105:Sars UTSW 3 108429305 missense probably damaging 1.00
R6282:Sars UTSW 3 108428274 nonsense probably null
R7224:Sars UTSW 3 108428203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCATGCGTTCTCTAGG -3'
(R):5'- GATGCAGTCTTTCCTCGCATG -3'

Sequencing Primer
(F):5'- TAGGCTCTTCCCCACCAAG -3'
(R):5'- GTATCCCTCCTCCAGGTGATTGG -3'
Posted On2015-02-05