Incidental Mutation 'R3104:Ctnnal1'
ID262944
Institutional Source Beutler Lab
Gene Symbol Ctnnal1
Ensembl Gene ENSMUSG00000038816
Gene Namecatenin (cadherin associated protein), alpha-like 1
SynonymsCatnal1, ACRP
MMRRC Submission 040578-MU
Accession Numbers

Genbank: NM_018761.3; Ensembl: ENSMUST00000045142, ENSMUST00000107612

Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56810935-56865188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56813246 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 662 (L662F)
Ref Sequence ENSEMBL: ENSMUSP00000036487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045142] [ENSMUST00000045368] [ENSMUST00000131520]
Predicted Effect probably benign
Transcript: ENSMUST00000045142
AA Change: L662F

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036487
Gene: ENSMUSG00000038816
AA Change: L662F

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Vinculin 30 309 7e-39 PFAM
Pfam:Vinculin 302 526 1.7e-12 PFAM
Pfam:Vinculin 531 683 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045368
SMART Domains Protein: ENSMUSP00000047275
Gene: ENSMUSG00000038827

DomainStartEndE-ValueType
Pfam:GCV_H 117 185 5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131231
Predicted Effect probably benign
Transcript: ENSMUST00000131520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134915
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and fertile and exhibit no overt phenotypes or defects in hematopoiesis and hematopoietic stem cell function. [provided by MGI curators]
Allele List at MGI

All alleles(111) : Targeted, other(2) Gene trapped(109)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Ctnnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Ctnnal1 APN 4 56829544 missense possibly damaging 0.90
IGL01404:Ctnnal1 APN 4 56829590 missense probably damaging 1.00
IGL01523:Ctnnal1 APN 4 56835243 missense probably damaging 1.00
IGL02413:Ctnnal1 APN 4 56835306 missense probably benign 0.19
IGL02618:Ctnnal1 APN 4 56817060 missense probably benign 0.07
IGL03109:Ctnnal1 APN 4 56839045 missense probably damaging 1.00
IGL03159:Ctnnal1 APN 4 56844599 missense probably benign 0.00
IGL03208:Ctnnal1 APN 4 56813833 missense probably benign 0.00
IGL03250:Ctnnal1 APN 4 56812356 missense probably benign 0.00
NA:Ctnnal1 UTSW 4 56817044 missense probably benign 0.02
R0217:Ctnnal1 UTSW 4 56813230 missense probably benign 0.43
R0391:Ctnnal1 UTSW 4 56847921 missense probably damaging 1.00
R0513:Ctnnal1 UTSW 4 56835348 missense probably benign 0.01
R0582:Ctnnal1 UTSW 4 56813228 missense probably damaging 1.00
R1434:Ctnnal1 UTSW 4 56847971 missense probably damaging 0.96
R1638:Ctnnal1 UTSW 4 56813856 missense probably benign 0.06
R1760:Ctnnal1 UTSW 4 56838988 missense probably damaging 1.00
R1871:Ctnnal1 UTSW 4 56812534 missense probably benign 0.06
R1954:Ctnnal1 UTSW 4 56817242 splice site probably benign
R2050:Ctnnal1 UTSW 4 56835350 missense probably benign 0.38
R2104:Ctnnal1 UTSW 4 56812329 makesense probably null
R3106:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3918:Ctnnal1 UTSW 4 56865000 missense possibly damaging 0.89
R4705:Ctnnal1 UTSW 4 56812579 missense probably benign 0.09
R4757:Ctnnal1 UTSW 4 56847980 missense probably damaging 1.00
R4780:Ctnnal1 UTSW 4 56847857 missense probably damaging 1.00
R4988:Ctnnal1 UTSW 4 56847854 nonsense probably null
R5771:Ctnnal1 UTSW 4 56826328 missense probably benign 0.00
R5974:Ctnnal1 UTSW 4 56817067 missense probably damaging 1.00
R6061:Ctnnal1 UTSW 4 56812349 missense probably benign
R6129:Ctnnal1 UTSW 4 56829573 missense possibly damaging 0.93
R6389:Ctnnal1 UTSW 4 56813849 missense probably benign 0.00
R7259:Ctnnal1 UTSW 4 56817299 critical splice acceptor site probably null
R7372:Ctnnal1 UTSW 4 56826285 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CAGACTCTGTGTGCACTTTAGC -3'
(R):5'- TCTTAAAATATAAGCACGGGGTGG -3'

Sequencing Primer
(F):5'- CACTTTAGCACGAAGGGCTG -3'
(R):5'- GCCAACCTGGTCTACATATGGAG -3'
Posted On2015-02-05