Incidental Mutation 'R3104:Prkag2'
ID262948
Institutional Source Beutler Lab
Gene Symbol Prkag2
Ensembl Gene ENSMUSG00000028944
Gene Nameprotein kinase, AMP-activated, gamma 2 non-catalytic subunit
Synonyms
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24862744-25100642 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 24871069 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 233 (K233*)
Ref Sequence ENSEMBL: ENSMUSP00000114978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030784] [ENSMUST00000076306] [ENSMUST00000114975] [ENSMUST00000131486] [ENSMUST00000150135]
Predicted Effect probably null
Transcript: ENSMUST00000030784
AA Change: K472*
SMART Domains Protein: ENSMUSP00000030784
Gene: ENSMUSG00000028944
AA Change: K472*

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
low complexity region 113 122 N/A INTRINSIC
low complexity region 129 144 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
CBS 276 325 7.01e-6 SMART
CBS 357 406 4.28e-10 SMART
CBS 432 480 8.11e-11 SMART
CBS 504 552 3.62e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076306
AA Change: K349*
SMART Domains Protein: ENSMUSP00000075651
Gene: ENSMUSG00000028944
AA Change: K349*

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
CBS 153 202 7.01e-6 SMART
CBS 234 283 4.28e-10 SMART
CBS 309 357 8.11e-11 SMART
CBS 381 429 3.62e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114975
AA Change: K232*
SMART Domains Protein: ENSMUSP00000110626
Gene: ENSMUSG00000028944
AA Change: K232*

DomainStartEndE-ValueType
CBS 36 85 7.01e-6 SMART
CBS 117 166 4.28e-10 SMART
CBS 192 240 8.11e-11 SMART
CBS 264 312 3.62e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129022
Predicted Effect probably benign
Transcript: ENSMUST00000131486
SMART Domains Protein: ENSMUSP00000115760
Gene: ENSMUSG00000028944

DomainStartEndE-ValueType
CBS 18 67 7.01e-6 SMART
CBS 99 148 4.28e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139698
Predicted Effect probably null
Transcript: ENSMUST00000150135
AA Change: K233*
SMART Domains Protein: ENSMUSP00000114978
Gene: ENSMUSG00000028944
AA Change: K233*

DomainStartEndE-ValueType
CBS 37 86 7.01e-6 SMART
CBS 118 167 4.28e-10 SMART
CBS 193 241 8.11e-11 SMART
Meta Mutation Damage Score 0.546 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AMP-activated protein kinase (AMPK) is a heterotrimeric protein composed of a catalytic alpha subunit, a noncatalytic beta subunit, and a noncatalytic regulatory gamma subunit. Various forms of each of these subunits exist, encoded by different genes. AMPK is an important energy-sensing enzyme that monitors cellular energy status and functions by inactivating key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This gene is a member of the AMPK gamma subunit family. Mutations in this gene have been associated with Wolff-Parkinson-White syndrome, familial hypertrophic cardiomyopathy, and glycogen storage disease of the heart. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous constitutively active mutants develop age related obesity caused by polyphagia, glucose intolerance and insulin resistance and exhibit slowing of heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Prkag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Prkag2 APN 5 25021965 missense probably benign 0.01
R0437:Prkag2 UTSW 5 25028505 missense possibly damaging 0.65
R0622:Prkag2 UTSW 5 24869249 missense probably damaging 0.98
R0755:Prkag2 UTSW 5 24947631 missense probably benign 0.25
R1400:Prkag2 UTSW 5 24873918 missense probably damaging 1.00
R1561:Prkag2 UTSW 5 24871595 missense probably damaging 1.00
R1569:Prkag2 UTSW 5 24947477 missense possibly damaging 0.59
R1612:Prkag2 UTSW 5 24877028 missense probably benign 0.06
R1615:Prkag2 UTSW 5 24875178 missense possibly damaging 0.56
R1700:Prkag2 UTSW 5 24871541 missense probably damaging 0.97
R2011:Prkag2 UTSW 5 24871054 critical splice donor site probably null
R2045:Prkag2 UTSW 5 24947582 missense possibly damaging 0.76
R2230:Prkag2 UTSW 5 24908364 missense probably benign 0.10
R2863:Prkag2 UTSW 5 25021792 missense probably benign 0.39
R4193:Prkag2 UTSW 5 24878760 missense probably damaging 1.00
R4520:Prkag2 UTSW 5 24866171 missense probably damaging 1.00
R4604:Prkag2 UTSW 5 24878734 missense probably damaging 1.00
R5736:Prkag2 UTSW 5 24878722 missense probably damaging 1.00
R6273:Prkag2 UTSW 5 24947536 missense probably damaging 0.96
R6414:Prkag2 UTSW 5 25100180 start gained probably benign
R6510:Prkag2 UTSW 5 25100288 start gained probably benign
R6511:Prkag2 UTSW 5 25100288 start gained probably benign
R7035:Prkag2 UTSW 5 24947566 missense probably damaging 1.00
R7084:Prkag2 UTSW 5 25021969 missense probably benign
R7211:Prkag2 UTSW 5 24995298 missense probably benign 0.00
R7353:Prkag2 UTSW 5 24880686 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATATAGCTCCCCTGAGAGGAG -3'
(R):5'- GCCCGTTTGTTTTACTGAACAC -3'

Sequencing Primer
(F):5'- CCCTGAGAGGAGACTGAAATTCTC -3'
(R):5'- CCACAGTAGTTACCTAGTTAAGACTG -3'
Posted On2015-02-05