Incidental Mutation 'R3104:Gtf2ird2'
ID262951
Institutional Source Beutler Lab
Gene Symbol Gtf2ird2
Ensembl Gene ENSMUSG00000015942
Gene NameGTF2I repeat domain containing 2
Synonyms1700012P16Rik
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134184019-134224355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134208915 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 278 (D278N)
Ref Sequence ENSEMBL: ENSMUSP00000016086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000123941]
Predicted Effect probably benign
Transcript: ENSMUST00000016086
AA Change: D278N

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: D278N

DomainStartEndE-ValueType
Pfam:GTF2I 104 178 6.1e-31 PFAM
Pfam:GTF2I 328 402 1.6e-25 PFAM
Blast:Tryp_SPc 436 491 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122780
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128842
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Gtf2ird2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gtf2ird2 APN 5 134196553 missense possibly damaging 0.93
IGL01295:Gtf2ird2 APN 5 134192764 missense probably damaging 1.00
IGL01603:Gtf2ird2 APN 5 134202288 splice site probably benign
IGL01824:Gtf2ird2 APN 5 134197282 splice site probably benign
IGL02469:Gtf2ird2 APN 5 134191249 missense probably damaging 1.00
IGL02525:Gtf2ird2 APN 5 134216477 missense probably benign 0.03
IGL02567:Gtf2ird2 APN 5 134213048 unclassified probably benign
IGL02750:Gtf2ird2 APN 5 134216889 missense probably damaging 0.99
IGL02992:Gtf2ird2 APN 5 134217614 missense possibly damaging 0.79
IGL03000:Gtf2ird2 APN 5 134194906 missense probably benign 0.45
IGL03114:Gtf2ird2 APN 5 134216910 unclassified probably null
IGL03180:Gtf2ird2 APN 5 134191248 missense probably damaging 1.00
R0077:Gtf2ird2 UTSW 5 134214083 missense probably damaging 1.00
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0344:Gtf2ird2 UTSW 5 134191249 missense probably damaging 1.00
R0568:Gtf2ird2 UTSW 5 134211242 nonsense probably null
R0570:Gtf2ird2 UTSW 5 134208944 critical splice donor site probably null
R0730:Gtf2ird2 UTSW 5 134192758 nonsense probably null
R0826:Gtf2ird2 UTSW 5 134216955 missense probably damaging 1.00
R1707:Gtf2ird2 UTSW 5 134216987 missense probably damaging 1.00
R1710:Gtf2ird2 UTSW 5 134211240 missense probably benign 0.26
R2064:Gtf2ird2 UTSW 5 134216498 nonsense probably null
R2284:Gtf2ird2 UTSW 5 134217183 missense probably benign 0.05
R2375:Gtf2ird2 UTSW 5 134217135 missense probably benign 0.20
R4436:Gtf2ird2 UTSW 5 134194969 missense possibly damaging 0.95
R4647:Gtf2ird2 UTSW 5 134216192 missense probably damaging 1.00
R4708:Gtf2ird2 UTSW 5 134216298 missense probably damaging 0.99
R4775:Gtf2ird2 UTSW 5 134214128 missense probably benign 0.01
R4999:Gtf2ird2 UTSW 5 134217464 missense probably damaging 0.97
R5011:Gtf2ird2 UTSW 5 134216982 missense possibly damaging 0.90
R5036:Gtf2ird2 UTSW 5 134217507 missense probably damaging 1.00
R5261:Gtf2ird2 UTSW 5 134216219 missense probably benign 0.00
R5379:Gtf2ird2 UTSW 5 134217468 missense probably benign
R5921:Gtf2ird2 UTSW 5 134217584 missense probably damaging 1.00
R6180:Gtf2ird2 UTSW 5 134216547 missense probably damaging 1.00
R6483:Gtf2ird2 UTSW 5 134211225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGTTCCCAGCACCCACA -3'
(R):5'- GGGACACAGCTCCATCACC -3'

Sequencing Primer
(F):5'- TCTCTGCGGATGTGAGCAAAC -3'
(R):5'- TTCACACATGGGAGCCTATG -3'
Posted On2015-02-05