Incidental Mutation 'R3104:Fam187b'
ID262959
Institutional Source Beutler Lab
Gene Symbol Fam187b
Ensembl Gene ENSMUSG00000046826
Gene Namefamily with sequence similarity 187, member B
Synonyms1700020B09Rik, Tmem162
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30973790-30989726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30977240 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 58 (D58G)
Ref Sequence ENSEMBL: ENSMUSP00000057020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058093] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000128384] [ENSMUST00000129773] [ENSMUST00000147431] [ENSMUST00000205961]
Predicted Effect probably benign
Transcript: ENSMUST00000001279
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058093
AA Change: D58G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000057020
Gene: ENSMUSG00000046826
AA Change: D58G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 27 116 4e-30 BLAST
Blast:IG_like 223 290 4e-6 BLAST
transmembrane domain 324 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098553
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128384
SMART Domains Protein: ENSMUSP00000144424
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 45 133 2e-17 BLAST
SCOP:d1wiu__ 53 125 1e-3 SMART
IG_like 238 306 1.9e-2 SMART
transmembrane domain 340 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129773
SMART Domains Protein: ENSMUSP00000144533
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
transmembrane domain 61 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206754
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Fam187b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0132:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0594:Fam187b UTSW 7 30977154 nonsense probably null
R1728:Fam187b UTSW 7 30989020 nonsense probably null
R2965:Fam187b UTSW 7 30977729 missense probably benign 0.44
R3106:Fam187b UTSW 7 30977240 missense probably benign 0.00
R4607:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4608:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4612:Fam187b UTSW 7 30977093 missense possibly damaging 0.69
R4672:Fam187b UTSW 7 30977543 missense probably damaging 1.00
R4801:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4802:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4959:Fam187b UTSW 7 30982262 missense probably damaging 1.00
R5820:Fam187b UTSW 7 30977152 missense probably damaging 1.00
R6351:Fam187b UTSW 7 30977599 missense probably damaging 1.00
R6624:Fam187b UTSW 7 30977187 missense probably benign 0.26
R6823:Fam187b UTSW 7 30989290 missense probably benign 0.01
X0063:Fam187b UTSW 7 30989320 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACGTCACAGTACCCAAGAAG -3'
(R):5'- TGATGTGCAACAGAGCTATGTTC -3'

Sequencing Primer
(F):5'- GTACCCAAGAAGGTTCTGAAGTTCC -3'
(R):5'- GCAACAGAGCTATGTTCTGAAAGTC -3'
Posted On2015-02-05