Incidental Mutation 'R3104:Cyp19a1'
ID262964
Institutional Source Beutler Lab
Gene Symbol Cyp19a1
Ensembl Gene ENSMUSG00000032274
Gene Namecytochrome P450, family 19, subfamily a, polypeptide 1
SynonymsCyp19, ArKO, Int-5, aromatase, p450arom, Int5, Ar
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54165937-54268110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54186799 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 60 (I60V)
Ref Sequence ENSEMBL: ENSMUSP00000034811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034811] [ENSMUST00000215736]
Predicted Effect probably benign
Transcript: ENSMUST00000034811
AA Change: I60V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034811
Gene: ENSMUSG00000032274
AA Change: I60V

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
Pfam:p450 46 488 1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217040
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for various mutations that inactivate the gene exhibit defects affecting fertility including impairments of ovulation, spermiogenesis and mounting behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Cyp19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Cyp19a1 APN 9 54168529 missense probably benign 0.03
IGL02885:Cyp19a1 APN 9 54171818 missense probably benign 0.25
IGL02897:Cyp19a1 APN 9 54166911 missense possibly damaging 0.95
R0384:Cyp19a1 UTSW 9 54172741 missense probably benign 0.01
R4116:Cyp19a1 UTSW 9 54168741 missense possibly damaging 0.94
R4158:Cyp19a1 UTSW 9 54186696 missense probably damaging 1.00
R4160:Cyp19a1 UTSW 9 54186696 missense probably damaging 1.00
R4555:Cyp19a1 UTSW 9 54166821 missense probably damaging 0.96
R4569:Cyp19a1 UTSW 9 54193323 missense probably benign 0.06
R4570:Cyp19a1 UTSW 9 54193323 missense probably benign 0.06
R4693:Cyp19a1 UTSW 9 54173333 missense possibly damaging 0.55
R4807:Cyp19a1 UTSW 9 54176646 missense possibly damaging 0.89
R4853:Cyp19a1 UTSW 9 54166776 missense probably benign
R4938:Cyp19a1 UTSW 9 54173363 missense probably benign 0.01
R5272:Cyp19a1 UTSW 9 54176614 missense probably benign 0.19
R6148:Cyp19a1 UTSW 9 54180256 missense probably damaging 1.00
R7008:Cyp19a1 UTSW 9 54193325 missense probably benign 0.35
R7472:Cyp19a1 UTSW 9 54166993 missense possibly damaging 0.55
X0025:Cyp19a1 UTSW 9 54168568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCGCTAAGGACACATTTCTTG -3'
(R):5'- AGCCATGCTTCTCATTCATGAAG -3'

Sequencing Primer
(F):5'- CTAAGGACACATTTCTTGCTGGGC -3'
(R):5'- CCATGCTTCTCATTCATGAAGAGGTG -3'
Posted On2015-02-05