Incidental Mutation 'R3105:Clca4b'
ID263001
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
SynonymsAI747448
MMRRC Submission 040579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3105 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144916671 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 544 (N544K)
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect probably benign
Transcript: ENSMUST00000098549
AA Change: N544K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195
AA Change: N544K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,175,043 probably benign Het
Abhd13 T C 8: 9,987,931 V176A probably benign Het
Alpk2 A T 18: 65,350,210 S242R possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc163 C A 4: 116,709,500 Q58K probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dip2b C A 15: 100,142,137 C138* probably null Het
Dnaja2 G A 8: 85,555,228 T7M probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
F11 T A 8: 45,245,717 Q463H probably damaging Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm8730 T C 8: 102,865,263 noncoding transcript Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lrp4 T C 2: 91,501,049 Y1585H probably benign Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Map2 T C 1: 66,433,597 probably null Het
Olfr1251 T C 2: 89,666,958 I309M probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Otof A G 5: 30,381,801 Y1090H probably benign Het
Pgr T A 9: 8,958,396 F801L probably benign Het
Pomk A C 8: 25,982,914 L337R probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sec16a G A 2: 26,438,421 P1194L probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Slc22a29 T C 19: 8,169,973 T342A probably benign Het
Spaca1 G A 4: 34,028,468 T283M probably damaging Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Taf6l C T 19: 8,778,855 S208N probably damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn1r205 T C 13: 22,592,939 probably benign Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0551:Clca4b UTSW 3 144928626 missense probably damaging 1.00
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3158:Clca4b UTSW 3 144912117 missense probably benign 0.04
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5409:Clca4b UTSW 3 144916691 nonsense probably null
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5671:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6122:Clca4b UTSW 3 144926166 missense possibly damaging 0.67
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6418:Clca4b UTSW 3 144928235 missense probably benign 0.02
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R6799:Clca4b UTSW 3 144915627 splice site probably null
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGGATCACACAGGTAAGG -3'
(R):5'- TGGCAAATCTATTCGGAGGG -3'

Sequencing Primer
(F):5'- TCACACAGGTAAGGAAAGTACATAC -3'
(R):5'- GAGAAAGCAAAGGTAAAACTGTTTTC -3'
Posted On2015-02-05