Incidental Mutation 'R3105:Ezh1'
ID263015
Institutional Source Beutler Lab
Gene Symbol Ezh1
Ensembl Gene ENSMUSG00000006920
Gene Nameenhancer of zeste 1 polycomb repressive complex 2 subunit
Synonyms
MMRRC Submission 040579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3105 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101191115-101226463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101195642 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 575 (C575W)
Ref Sequence ENSEMBL: ENSMUSP00000102906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100417] [ENSMUST00000103109] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect probably benign
Transcript: ENSMUST00000100417
SMART Domains Protein: ENSMUSP00000097984
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 1.8e-20 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
PDB:4MI0|A 521 558 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107284
AA Change: C572W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920
AA Change: C572W

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107285
AA Change: C575W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920
AA Change: C575W

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146884
Meta Mutation Damage Score 0.666 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the Polycomb-group (PcG) family. The encoded protein is interchangeable with the related Enhancer of zeste 2 (Ezh2) protein as a core component of the polycomb repressive complex 2 (PRC2), which methylates histone H3 at lysine 27 and results in the transcriptional repression of affected target genes. This complex is involved in carrying out cell-fate decisions during embryonic stem cell differentiation. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and healthy. Mice homozygous for a conditional allele activated in hematopoietic stem cells exhibit bone marrow failure with defective HSC maintenance and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,175,043 probably benign Het
Abhd13 T C 8: 9,987,931 V176A probably benign Het
Alpk2 A T 18: 65,350,210 S242R possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc163 C A 4: 116,709,500 Q58K probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dip2b C A 15: 100,142,137 C138* probably null Het
Dnaja2 G A 8: 85,555,228 T7M probably damaging Het
F11 T A 8: 45,245,717 Q463H probably damaging Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm8730 T C 8: 102,865,263 noncoding transcript Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lrp4 T C 2: 91,501,049 Y1585H probably benign Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Map2 T C 1: 66,433,597 probably null Het
Olfr1251 T C 2: 89,666,958 I309M probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Otof A G 5: 30,381,801 Y1090H probably benign Het
Pgr T A 9: 8,958,396 F801L probably benign Het
Pomk A C 8: 25,982,914 L337R probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sec16a G A 2: 26,438,421 P1194L probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Slc22a29 T C 19: 8,169,973 T342A probably benign Het
Spaca1 G A 4: 34,028,468 T283M probably damaging Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Taf6l C T 19: 8,778,855 S208N probably damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn1r205 T C 13: 22,592,939 probably benign Het
Other mutations in Ezh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ezh1 APN 11 101194506 unclassified probably null
IGL00481:Ezh1 APN 11 101199302 missense possibly damaging 0.68
IGL01327:Ezh1 APN 11 101203436 missense probably damaging 0.97
IGL01475:Ezh1 APN 11 101192961 missense probably damaging 1.00
IGL01693:Ezh1 APN 11 101215258 missense probably benign
IGL01896:Ezh1 APN 11 101213755 missense probably benign 0.00
IGL02022:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02024:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02028:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02053:Ezh1 APN 11 101199943 splice site probably benign
IGL02101:Ezh1 APN 11 101195566 missense possibly damaging 0.50
IGL02445:Ezh1 APN 11 101210687 missense possibly damaging 0.49
IGL02882:Ezh1 APN 11 101203289 missense probably benign 0.02
IGL03303:Ezh1 APN 11 101195671 unclassified probably null
IGL03493:Ezh1 APN 11 101203791 missense probably benign 0.02
R1099:Ezh1 UTSW 11 101193808 critical splice acceptor site probably null
R1119:Ezh1 UTSW 11 101210535 splice site probably benign
R1434:Ezh1 UTSW 11 101194917 missense probably damaging 1.00
R1477:Ezh1 UTSW 11 101192984 missense probably damaging 0.98
R2114:Ezh1 UTSW 11 101208185 missense probably benign 0.04
R3106:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R4272:Ezh1 UTSW 11 101194908 missense probably damaging 1.00
R4820:Ezh1 UTSW 11 101203768 missense probably damaging 1.00
R5016:Ezh1 UTSW 11 101199237 intron probably benign
R5237:Ezh1 UTSW 11 101216993 critical splice donor site probably null
R6392:Ezh1 UTSW 11 101203804 missense probably damaging 0.96
R6892:Ezh1 UTSW 11 101199361 nonsense probably null
R7215:Ezh1 UTSW 11 101215299 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAACAATGACACCTGGTAAC -3'
(R):5'- GGCACTTCCTTGTCTTGAGG -3'

Sequencing Primer
(F):5'- GGTAACATTTCCTCCTTCCCACTG -3'
(R):5'- CACTTCCTTGTCTTGAGGGAAAAGC -3'
Posted On2015-02-05