Incidental Mutation 'R3105:Sfmbt1'
ID263017
Institutional Source Beutler Lab
Gene Symbol Sfmbt1
Ensembl Gene ENSMUSG00000006527
Gene NameScm-like with four mbt domains 1
Synonyms4930442N21Rik, 9330180L21Rik, Smr
MMRRC Submission 040579-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R3105 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30714849-30822721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30817796 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 847 (C847Y)
Ref Sequence ENSEMBL: ENSMUSP00000153861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054230] [ENSMUST00000112184] [ENSMUST00000227201] [ENSMUST00000227303] [ENSMUST00000228006]
Predicted Effect probably damaging
Transcript: ENSMUST00000054230
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056744
Gene: ENSMUSG00000006527
AA Change: C847Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112177
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107799
Gene: ENSMUSG00000006527
AA Change: C847Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112184
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107802
Gene: ENSMUSG00000006527
AA Change: C847Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 499 614 3.1e-41 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000227201
Predicted Effect probably damaging
Transcript: ENSMUST00000227303
AA Change: C804Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228006
AA Change: C847Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.412 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares high similarity with the Drosophila Scm (sex comb on midleg) gene. It encodes a protein which contains four malignant brain tumor repeat (mbt) domains and may be involved in antigen recognition. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,175,043 probably benign Het
Abhd13 T C 8: 9,987,931 V176A probably benign Het
Alpk2 A T 18: 65,350,210 S242R possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc163 C A 4: 116,709,500 Q58K probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dip2b C A 15: 100,142,137 C138* probably null Het
Dnaja2 G A 8: 85,555,228 T7M probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
F11 T A 8: 45,245,717 Q463H probably damaging Het
Gfpt1 A G 6: 87,057,646 D142G probably benign Het
Gm8730 T C 8: 102,865,263 noncoding transcript Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lrp4 T C 2: 91,501,049 Y1585H probably benign Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Map2 T C 1: 66,433,597 probably null Het
Olfr1251 T C 2: 89,666,958 I309M probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Otof A G 5: 30,381,801 Y1090H probably benign Het
Pgr T A 9: 8,958,396 F801L probably benign Het
Pomk A C 8: 25,982,914 L337R probably damaging Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sec16a G A 2: 26,438,421 P1194L probably benign Het
Slc22a29 T C 19: 8,169,973 T342A probably benign Het
Spaca1 G A 4: 34,028,468 T283M probably damaging Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Taf6l C T 19: 8,778,855 S208N probably damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn1r205 T C 13: 22,592,939 probably benign Het
Other mutations in Sfmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Sfmbt1 APN 14 30810311 missense probably damaging 1.00
IGL01351:Sfmbt1 APN 14 30769820 missense probably benign 0.00
IGL01478:Sfmbt1 APN 14 30811521 missense probably damaging 1.00
IGL01632:Sfmbt1 APN 14 30817712 missense probably damaging 1.00
IGL02252:Sfmbt1 APN 14 30817733 missense probably damaging 1.00
IGL02456:Sfmbt1 APN 14 30785880 missense probably damaging 0.99
IGL02651:Sfmbt1 APN 14 30815537 missense probably damaging 1.00
IGL02967:Sfmbt1 APN 14 30816802 missense probably damaging 1.00
PIT4142001:Sfmbt1 UTSW 14 30816757 unclassified probably null
PIT4519001:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
PIT4531001:Sfmbt1 UTSW 14 30796326 missense probably benign 0.00
R0043:Sfmbt1 UTSW 14 30816807 missense probably damaging 0.99
R0389:Sfmbt1 UTSW 14 30811507 missense probably damaging 1.00
R0395:Sfmbt1 UTSW 14 30787617 splice site probably benign
R0562:Sfmbt1 UTSW 14 30811373 intron probably null
R1083:Sfmbt1 UTSW 14 30787541 missense possibly damaging 0.92
R1900:Sfmbt1 UTSW 14 30802567 missense probably damaging 1.00
R2447:Sfmbt1 UTSW 14 30773893 missense possibly damaging 0.62
R3104:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3106:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R4038:Sfmbt1 UTSW 14 30787492 missense probably damaging 1.00
R5118:Sfmbt1 UTSW 14 30790770 missense probably damaging 1.00
R5227:Sfmbt1 UTSW 14 30815254 critical splice donor site probably null
R5286:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5287:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5295:Sfmbt1 UTSW 14 30774029 missense probably damaging 1.00
R5620:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
R6113:Sfmbt1 UTSW 14 30815184 missense possibly damaging 0.68
R6139:Sfmbt1 UTSW 14 30811418 missense probably damaging 1.00
R6429:Sfmbt1 UTSW 14 30773911 missense probably damaging 1.00
R6657:Sfmbt1 UTSW 14 30766096 missense possibly damaging 0.50
R6955:Sfmbt1 UTSW 14 30766034 start gained probably benign
R6957:Sfmbt1 UTSW 14 30787589 missense probably benign 0.00
R7206:Sfmbt1 UTSW 14 30811373 intron probably null
R7337:Sfmbt1 UTSW 14 30784739 missense possibly damaging 0.62
X0064:Sfmbt1 UTSW 14 30815205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTAGCAGACTATGGTTC -3'
(R):5'- GTGCAAAGATAGCAAGCCAC -3'

Sequencing Primer
(F):5'- AGCAGACTATGGTTCTTTTCAAAGGG -3'
(R):5'- ACCACTTGCAGGCCGACAG -3'
Posted On2015-02-05