Incidental Mutation 'R3106:Atp5c1'
ID263034
Institutional Source Beutler Lab
Gene Symbol Atp5c1
Ensembl Gene ENSMUSG00000025781
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
SynonymsF1 gamma, 1700094F02Rik
MMRRC Submission 040580-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R3106 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location10056016-10080510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10063465 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 160 (S160P)
Ref Sequence ENSEMBL: ENSMUSP00000110546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026887] [ENSMUST00000114896] [ENSMUST00000114897] [ENSMUST00000130067] [ENSMUST00000139810] [ENSMUST00000145530] [ENSMUST00000153554]
Predicted Effect probably benign
Transcript: ENSMUST00000026887
AA Change: S184P

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026887
Gene: ENSMUSG00000025781
AA Change: S184P

DomainStartEndE-ValueType
Pfam:ATP-synt 26 297 1.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114896
AA Change: S160P

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110546
Gene: ENSMUSG00000025781
AA Change: S160P

DomainStartEndE-ValueType
Pfam:ATP-synt 2 273 1.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114897
AA Change: S184P

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110547
Gene: ENSMUSG00000025781
AA Change: S184P

DomainStartEndE-ValueType
Pfam:ATP-synt 27 297 6.8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130067
SMART Domains Protein: ENSMUSP00000117182
Gene: ENSMUSG00000025781

DomainStartEndE-ValueType
Pfam:ATP-synt 2 101 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139810
SMART Domains Protein: ENSMUSP00000123100
Gene: ENSMUSG00000025781

DomainStartEndE-ValueType
Pfam:ATP-synt 2 153 6.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145530
AA Change: S160P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116508
Gene: ENSMUSG00000025781
AA Change: S160P

DomainStartEndE-ValueType
Pfam:ATP-synt 2 187 1.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153554
AA Change: S160P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116368
Gene: ENSMUSG00000025781
AA Change: S160P

DomainStartEndE-ValueType
Pfam:ATP-synt 2 171 1.2e-43 PFAM
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Adarb1 C A 10: 77,321,757 K285N probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hist1h1c G T 13: 23,738,900 A18S unknown Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lemd2 C A 17: 27,201,670 L256F probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pan3 T C 5: 147,539,379 probably benign Het
Pld3 A G 7: 27,535,787 probably null Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn2r-ps159 T A 4: 156,333,435 noncoding transcript Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Atp5c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Atp5c1 APN 2 10068666 missense probably damaging 1.00
R4651:Atp5c1 UTSW 2 10063476 missense probably damaging 1.00
R4670:Atp5c1 UTSW 2 10059617 missense probably damaging 1.00
R5097:Atp5c1 UTSW 2 10063512 missense probably benign 0.01
R5275:Atp5c1 UTSW 2 10068733 missense possibly damaging 0.51
R5295:Atp5c1 UTSW 2 10068733 missense possibly damaging 0.51
R6195:Atp5c1 UTSW 2 10064115 missense possibly damaging 0.79
R6536:Atp5c1 UTSW 2 10080316 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTGAGGTCTCCTGACACAC -3'
(R):5'- GCTATTTTCTTACAGCACAGTGTC -3'

Sequencing Primer
(F):5'- TACCAGCAGTCGCAATGGTATTC -3'
(R):5'- TTACAGCACAGTGTCTCATTAACC -3'
Posted On2015-02-05