Incidental Mutation 'R3106:Pan3'
ID263053
Institutional Source Beutler Lab
Gene Symbol Pan3
Ensembl Gene ENSMUSG00000029647
Gene NamePAN3 poly(A) specific ribonuclease subunit
Synonyms2700050F09Rik, A430027N15Rik
MMRRC Submission 040580-MU
Accession Numbers

Genbank: NM_028291.4; Ensembl: ENSMUST00000031651

Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R3106 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147430161-147548502 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 147539379 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031651] [ENSMUST00000175807] [ENSMUST00000176553] [ENSMUST00000176600]
Predicted Effect probably benign
Transcript: ENSMUST00000031651
SMART Domains Protein: ENSMUSP00000031651
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
PDB:4BWP|B 391 829 1e-161 PDB
Blast:S_TKc 439 607 2e-8 BLAST
SCOP:d1pme__ 453 602 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175807
SMART Domains Protein: ENSMUSP00000135729
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
PDB:4BWP|B 51 450 1e-134 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176505
Predicted Effect probably benign
Transcript: ENSMUST00000176553
SMART Domains Protein: ENSMUSP00000134911
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
PDB:4BWP|B 1 142 5e-66 PDB
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176596
Predicted Effect probably benign
Transcript: ENSMUST00000176600
SMART Domains Protein: ENSMUSP00000135367
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
PDB:4BWP|B 445 883 1e-161 PDB
Blast:S_TKc 493 661 2e-8 BLAST
SCOP:d1pme__ 507 656 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176753
SMART Domains Protein: ENSMUSP00000134989
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
low complexity region 173 190 N/A INTRINSIC
PDB:4BWP|B 246 684 1e-164 PDB
Blast:S_TKc 294 462 1e-8 BLAST
SCOP:d1pme__ 308 457 8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176856
Predicted Effect probably benign
Transcript: ENSMUST00000177465
SMART Domains Protein: ENSMUSP00000134810
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177496
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
Allele List at MGI

 All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Adarb1 C A 10: 77,321,757 K285N probably damaging Het
Atp5c1 A G 2: 10,063,465 S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hist1h1c G T 13: 23,738,900 A18S unknown Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lemd2 C A 17: 27,201,670 L256F probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pld3 A G 7: 27,535,787 probably null Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn2r-ps159 T A 4: 156,333,435 noncoding transcript Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Pan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Pan3 APN 5 147529973 missense probably benign 0.05
IGL01612:Pan3 APN 5 147453242 splice site probably benign
IGL02187:Pan3 APN 5 147526588 missense probably benign 0.21
IGL02324:Pan3 APN 5 147530123 splice site probably null
IGL02328:Pan3 APN 5 147530123 splice site probably null
IGL02507:Pan3 APN 5 147526596 missense probably damaging 0.98
IGL03144:Pan3 APN 5 147450781 splice site probably benign
3-1:Pan3 UTSW 5 147526575 missense probably benign 0.14
R2145:Pan3 UTSW 5 147530098 missense possibly damaging 0.87
R2174:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R2504:Pan3 UTSW 5 147527036 missense possibly damaging 0.87
R3723:Pan3 UTSW 5 147503208 intron probably benign
R3944:Pan3 UTSW 5 147450730 missense probably damaging 1.00
R4589:Pan3 UTSW 5 147543173 missense probably damaging 0.98
R4647:Pan3 UTSW 5 147527203 missense probably damaging 1.00
R4811:Pan3 UTSW 5 147530058 missense probably damaging 1.00
R5001:Pan3 UTSW 5 147526682 critical splice donor site probably null
R5126:Pan3 UTSW 5 147527198 missense probably benign 0.00
R5215:Pan3 UTSW 5 147455105 splice site probably null
R5317:Pan3 UTSW 5 147543210 critical splice donor site probably null
R5496:Pan3 UTSW 5 147527128 critical splice acceptor site probably null
R5687:Pan3 UTSW 5 147455172 missense probably damaging 1.00
R6147:Pan3 UTSW 5 147548283 unclassified probably benign
R6539:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R7008:Pan3 UTSW 5 147545693 missense probably damaging 0.99
R7047:Pan3 UTSW 5 147546365 missense probably damaging 0.97
R7226:Pan3 UTSW 5 147526992 missense probably damaging 1.00
R7453:Pan3 UTSW 5 147526681 critical splice donor site probably null
X0060:Pan3 UTSW 5 147543133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTGCTGACCATTCATG -3'
(R):5'- ACATATGCCTACTTTTGTGCAC -3'

Sequencing Primer
(F):5'- ATTCATGGGGTTCTTCTCTGTC -3'
(R):5'- GCACAGTTGTACTCAGGAGATTATGC -3'
Posted On2015-02-05