Incidental Mutation 'R3106:Dgkg'
ID263080
Institutional Source Beutler Lab
Gene Symbol Dgkg
Ensembl Gene ENSMUSG00000022861
Gene Namediacylglycerol kinase, gamma
SynonymsE430001K23Rik, 2900055E17Rik, Dagk3
MMRRC Submission 040580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3106 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22468461-22657221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22575341 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 321 (T321S)
Ref Sequence ENSEMBL: ENSMUSP00000023578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023578] [ENSMUST00000089925] [ENSMUST00000137311]
Predicted Effect probably damaging
Transcript: ENSMUST00000023578
AA Change: T321S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023578
Gene: ENSMUSG00000022861
AA Change: T321S

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 9.3e-66 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
DAGKc 392 516 5.29e-65 SMART
DAGKa 536 710 1.25e-116 SMART
low complexity region 735 748 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089925
AA Change: T321S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087371
Gene: ENSMUSG00000022861
AA Change: T321S

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 5 172 3.9e-54 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
C1 334 380 3.35e-3 SMART
DAGKc 431 555 5.29e-65 SMART
DAGKa 575 749 1.25e-116 SMART
low complexity region 774 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137311
AA Change: T321S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114441
Gene: ENSMUSG00000022861
AA Change: T321S

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 2 172 3.8e-67 PFAM
EFh 176 204 8.13e-2 SMART
EFh 221 249 1.07e-1 SMART
C1 269 318 1.23e-10 SMART
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the type I subfamily of diacylglycerol kinases, which are involved in lipid metabolism. These enzymes generate phosphatidic acid by catalyzing the phosphorylation of diacylglycerol, a fundamental lipid second messenger that activates numerous proteins, including protein kinase C isoforms, Ras guanyl nucleotide-releasing proteins and some transient receptor potential channels. Diacylglycerol kinase gamma has been implicated in cell cycle regulation and in the negative regulation of macrophage differentiation in leukemia cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Adarb1 C A 10: 77,321,757 K285N probably damaging Het
Atp5c1 A G 2: 10,063,465 S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hist1h1c G T 13: 23,738,900 A18S unknown Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lemd2 C A 17: 27,201,670 L256F probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pan3 T C 5: 147,539,379 probably benign Het
Pld3 A G 7: 27,535,787 probably null Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn2r-ps159 T A 4: 156,333,435 noncoding transcript Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Dgkg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Dgkg APN 16 22479362 splice site probably benign
IGL01347:Dgkg APN 16 22600590 missense probably benign 0.13
IGL02313:Dgkg APN 16 22570230 splice site probably benign
IGL02498:Dgkg APN 16 22548691 missense probably damaging 1.00
IGL02954:Dgkg APN 16 22622253 missense probably benign 0.00
IGL03103:Dgkg APN 16 22580525 missense probably damaging 1.00
R0014:Dgkg UTSW 16 22565364 splice site probably null
R0636:Dgkg UTSW 16 22579729 splice site probably benign
R0666:Dgkg UTSW 16 22562730 missense probably damaging 1.00
R1056:Dgkg UTSW 16 22600541 missense probably damaging 1.00
R1495:Dgkg UTSW 16 22500379 missense probably damaging 1.00
R1603:Dgkg UTSW 16 22570159 splice site probably benign
R1993:Dgkg UTSW 16 22600594 missense probably damaging 1.00
R2073:Dgkg UTSW 16 22565317 missense probably damaging 0.96
R2192:Dgkg UTSW 16 22588299 missense probably damaging 0.98
R2251:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R2252:Dgkg UTSW 16 22622260 start codon destroyed probably null 0.98
R3104:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R3105:Dgkg UTSW 16 22575341 missense probably damaging 1.00
R4804:Dgkg UTSW 16 22575193 intron probably benign
R5272:Dgkg UTSW 16 22588294 splice site probably null
R5364:Dgkg UTSW 16 22600461 missense probably benign 0.03
R5417:Dgkg UTSW 16 22588331 missense possibly damaging 0.50
R5677:Dgkg UTSW 16 22570171 missense probably benign 0.00
R5839:Dgkg UTSW 16 22566494 missense possibly damaging 0.91
R5931:Dgkg UTSW 16 22558038 nonsense probably null
R6313:Dgkg UTSW 16 22519561 missense probably damaging 0.96
R7017:Dgkg UTSW 16 22572713 missense probably benign 0.31
R7135:Dgkg UTSW 16 22500382 missense probably damaging 1.00
R7326:Dgkg UTSW 16 22548690 missense probably damaging 1.00
R7476:Dgkg UTSW 16 22622304 start gained probably benign
Z1088:Dgkg UTSW 16 22469328 missense probably damaging 0.96
Z1088:Dgkg UTSW 16 22572686 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CTTCAGGGAGGTGCTGAATG -3'
(R):5'- AGTGTCAGGTTTCTGCTAAGCC -3'

Sequencing Primer
(F):5'- ATTGATGGATGAGTGTAATGGCTC -3'
(R):5'- TTTCTGCTAAGCCAGGCCAG -3'
Posted On2015-02-05