Incidental Mutation 'R0294:Nnt'
ID26310
Institutional Source Beutler Lab
Gene Symbol Nnt
Ensembl Gene ENSMUSG00000025453
Gene Namenicotinamide nucleotide transhydrogenase
Synonyms
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R0294 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location119335448-119408997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119338417 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 659 (I659L)
Ref Sequence ENSEMBL: ENSMUSP00000070564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069902] [ENSMUST00000099149] [ENSMUST00000223268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069902
AA Change: I659L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070564
Gene: ENSMUSG00000025453
AA Change: I659L

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 377 5.76e-43 SMART
transmembrane domain 409 431 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
PDB:1U31|B 515 721 1e-145 PDB
SCOP:d1d4oa_ 542 718 1e-103 SMART
Predicted Effect unknown
Transcript: ENSMUST00000099149
AA Change: I773L
SMART Domains Protein: ENSMUSP00000096753
Gene: ENSMUSG00000025453
AA Change: I773L

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 3e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 835 1e-143 PDB
SCOP:d1d4oa_ 656 832 1e-102 SMART
Predicted Effect unknown
Transcript: ENSMUST00000223268
AA Change: I773L
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene cause impaired glucose tolerance and loss of both glucose-dependent insulin secretion and ATP production in isolated pancreatic islets. Also, beta cells from ENU-induced mutants show enhanced glucose utilization and production of reactive oxygen species in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Dock8 T C 19: 25,188,350 I1866T probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Il5ra A T 6: 106,712,401 M410K probably benign Het
Ints7 A G 1: 191,611,891 S548G possibly damaging Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mgst2 A G 3: 51,681,830 Y88C probably damaging Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr506 A T 7: 108,613,150 Y281F probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Slc5a4b A G 10: 76,081,327 C292R probably damaging Het
Sphkap T A 1: 83,278,245 E594D possibly damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Nnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nnt APN 13 119369997 missense probably damaging 1.00
IGL02021:Nnt APN 13 119336247 utr 3 prime probably benign
IGL02792:Nnt APN 13 119357646 missense probably damaging 1.00
IGL02804:Nnt APN 13 119381674 critical splice donor site probably null
IGL03082:Nnt APN 13 119396868 missense probably damaging 1.00
R0122:Nnt UTSW 13 119368597 missense probably damaging 1.00
R0294:Nnt UTSW 13 119336267 missense probably benign 0.08
R0530:Nnt UTSW 13 119394721 missense probably damaging 1.00
R0839:Nnt UTSW 13 119394656 missense possibly damaging 0.86
R1590:Nnt UTSW 13 119386661 missense possibly damaging 0.90
R1642:Nnt UTSW 13 119404550 critical splice donor site probably null
R3772:Nnt UTSW 13 119396952 missense probably damaging 0.99
R3835:Nnt UTSW 13 119372495 missense probably damaging 1.00
R3921:Nnt UTSW 13 119366494 missense probably damaging 1.00
R4106:Nnt UTSW 13 119396791 missense probably benign 0.15
R4496:Nnt UTSW 13 119381765 missense probably damaging 1.00
R4609:Nnt UTSW 13 119357536 missense possibly damaging 0.80
R4897:Nnt UTSW 13 119404571 nonsense probably null
R5081:Nnt UTSW 13 119366400 missense probably damaging 0.98
R5461:Nnt UTSW 13 119368595 missense possibly damaging 0.96
R5842:Nnt UTSW 13 119394747 missense probably damaging 0.97
R6053:Nnt UTSW 13 119357509 missense possibly damaging 0.90
R6137:Nnt UTSW 13 119336328 missense possibly damaging 0.95
R7134:Nnt UTSW 13 119394662 missense probably damaging 0.98
Z1088:Nnt UTSW 13 119338446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTCCCGAGCCTCCTAAAAGG -3'
(R):5'- TAAAGCAGGCTTCGGTCAGGACAG -3'

Sequencing Primer
(F):5'- GCATCACCCGTTCCCATTAAG -3'
(R):5'- TGTATGTAGCACCTGGCACAG -3'
Posted On2013-04-16