Mutagenetix > Incidental Mutation

Incidental Mutation 'R3118:Tbx15'

263117

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

Tbx8, de, Tbx14

MMRRC Submission

040591-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R3118 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99147697-99261575 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99259470 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 447 (I447T)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: I447T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: I447T

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	T	G	13: 104,450,787 (GRCm39)	D323E	possibly damaging	Het
Ccdc125	T	C	13: 100,826,827 (GRCm39)	V228A	possibly damaging	Het
Chrna2	A	G	14: 66,388,442 (GRCm39)	I486V	probably damaging	Het
Cpxm1	T	C	2: 130,235,493 (GRCm39)	T500A	possibly damaging	Het
Crebbp	G	A	16: 3,927,062 (GRCm39)	R628C	probably damaging	Het
Cxcl1	T	A	5: 91,039,454 (GRCm39)		probably null	Het
Dab1	G	A	4: 104,537,266 (GRCm39)		probably null	Het
Ddx11	T	A	17: 66,456,272 (GRCm39)	M751K	probably damaging	Het
Ece1	A	G	4: 137,675,855 (GRCm39)	T410A	probably benign	Het
Eml5	C	T	12: 98,831,753 (GRCm39)	V402I	probably damaging	Het
Fam241b	A	T	10: 61,944,635 (GRCm39)	*121R	probably null	Het
Fras1	G	A	5: 96,919,571 (GRCm39)	A3595T	probably damaging	Het
Gpr149	A	G	3: 62,502,443 (GRCm39)	V471A	probably benign	Het
Lemd3	A	G	10: 120,783,156 (GRCm39)	S557P	probably benign	Het
Mkrn3	CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA	CGGCATTGGCACTGGCATTGGCA	7: 62,068,962 (GRCm39)		probably benign	Het
Mmp7	T	C	9: 7,697,693 (GRCm39)	Y243H	probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Pak6	T	C	2: 118,520,222 (GRCm39)	V71A	probably damaging	Het
Pira2	T	A	7: 3,844,676 (GRCm39)	R452*	probably null	Het
Plxna1	A	G	6: 89,333,958 (GRCm39)	S224P	possibly damaging	Het
Prpf39	T	C	12: 65,104,651 (GRCm39)	V572A	possibly damaging	Het
Prss12	A	T	3: 123,298,976 (GRCm39)	T583S	possibly damaging	Het
Rgs10	T	C	7: 128,004,955 (GRCm39)	E65G	probably damaging	Het
Rnf19a	T	A	15: 36,242,045 (GRCm39)	K665*	probably null	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Tmem135	A	G	7: 88,797,005 (GRCm39)	S364P	probably benign	Het
Ugt1a9	T	C	1: 87,998,562 (GRCm39)	V4A	probably benign	Het
Zfp595	T	C	13: 67,468,963 (GRCm39)	I95M	probably benign	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99,223,562 (GRCm39)	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99,223,544 (GRCm39)	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99,220,358 (GRCm39)	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99,259,800 (GRCm39)	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99,259,826 (GRCm39)	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99,259,514 (GRCm39)	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99,259,296 (GRCm39)	missense	probably benign	0.00
shin_guard	UTSW	3	99,259,508 (GRCm39)	missense	possibly damaging	0.90
Shortcut	UTSW	3	99,220,389 (GRCm39)	nonsense	probably null
R0012:Tbx15	UTSW	3	99,259,412 (GRCm39)	missense	probably benign
R0109:Tbx15	UTSW	3	99,259,182 (GRCm39)	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99,259,707 (GRCm39)	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99,223,634 (GRCm39)	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99,223,639 (GRCm39)	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99,259,427 (GRCm39)	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99,259,427 (GRCm39)	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99,259,228 (GRCm39)	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99,259,140 (GRCm39)	splice site	probably null
R1762:Tbx15	UTSW	3	99,259,260 (GRCm39)	nonsense	probably null
R1789:Tbx15	UTSW	3	99,259,562 (GRCm39)	nonsense	probably null
R2167:Tbx15	UTSW	3	99,233,771 (GRCm39)	splice site	probably benign
R2254:Tbx15	UTSW	3	99,259,190 (GRCm39)	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99,223,672 (GRCm39)	splice site	probably null
R2441:Tbx15	UTSW	3	99,259,827 (GRCm39)	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99,161,209 (GRCm39)	intron	probably benign
R4081:Tbx15	UTSW	3	99,220,370 (GRCm39)	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99,259,683 (GRCm39)	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99,259,583 (GRCm39)	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99,233,700 (GRCm39)	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99,161,390 (GRCm39)	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99,223,649 (GRCm39)	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99,259,362 (GRCm39)	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99,223,600 (GRCm39)	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99,259,508 (GRCm39)	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99,259,880 (GRCm39)	missense	probably benign
R5690:Tbx15	UTSW	3	99,216,166 (GRCm39)	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99,220,402 (GRCm39)	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99,259,833 (GRCm39)	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99,259,833 (GRCm39)	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99,220,431 (GRCm39)	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99,161,203 (GRCm39)	nonsense	probably null
R6596:Tbx15	UTSW	3	99,259,508 (GRCm39)	missense	probably benign
R6680:Tbx15	UTSW	3	99,220,389 (GRCm39)	nonsense	probably null
R6931:Tbx15	UTSW	3	99,259,467 (GRCm39)	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99,161,254 (GRCm39)	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99,259,886 (GRCm39)	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99,259,305 (GRCm39)	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99,220,376 (GRCm39)	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99,222,219 (GRCm39)	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99,222,085 (GRCm39)	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99,233,708 (GRCm39)	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99,259,647 (GRCm39)	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99,222,151 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGCCCCGAATACTTTCAATG -3'
(R):5'- AGAAGGCATTATAGGAGCTCTGC -3'

Sequencing Primer
(F):5'- CCGAATACTTTCAATGTGGGC -3'
(R):5'- AGCTCTGCTGCATGTGGC -3'

Posted On

2015-02-05