Incidental Mutation 'R3118:Zfp595'
ID263134
Institutional Source Beutler Lab
Gene Symbol Zfp595
Ensembl Gene ENSMUSG00000057842
Gene Namezinc finger protein 595
Synonyms
MMRRC Submission 040591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R3118 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67312998-67332570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67320899 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 95 (I95M)
Ref Sequence ENSEMBL: ENSMUSP00000049225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044819] [ENSMUST00000109735] [ENSMUST00000168892] [ENSMUST00000169142] [ENSMUST00000171466]
Predicted Effect probably benign
Transcript: ENSMUST00000044819
AA Change: I95M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049225
Gene: ENSMUSG00000098781
AA Change: I95M

DomainStartEndE-ValueType
KRAB 5 65 1.15e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109735
AA Change: Y21C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105357
Gene: ENSMUSG00000057842
AA Change: Y21C

DomainStartEndE-ValueType
KRAB 5 65 1.57e-30 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 6.57e-1 SMART
ZnF_C2H2 137 159 4.38e1 SMART
ZnF_C2H2 165 187 2.91e-2 SMART
ZnF_C2H2 193 215 2.36e-2 SMART
ZnF_C2H2 221 243 2.79e-4 SMART
PHD 222 283 4.64e0 SMART
ZnF_C2H2 249 271 4.47e-3 SMART
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 4.54e-4 SMART
ZnF_C2H2 333 355 8.94e-3 SMART
PHD 334 395 1.2e1 SMART
ZnF_C2H2 361 383 2.02e-1 SMART
ZnF_C2H2 389 411 2.75e-3 SMART
ZnF_C2H2 417 439 1.26e-2 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
PHD 446 507 1.12e0 SMART
ZnF_C2H2 473 495 4.79e-3 SMART
ZnF_C2H2 501 523 2.09e-3 SMART
ZnF_C2H2 529 551 2.95e-3 SMART
ZnF_C2H2 557 579 5.14e-3 SMART
ZnF_C2H2 585 607 2.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133177
Predicted Effect probably benign
Transcript: ENSMUST00000168892
AA Change: Y21C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126862
Gene: ENSMUSG00000057842
AA Change: Y21C

DomainStartEndE-ValueType
KRAB 5 65 1.57e-30 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 6.57e-1 SMART
ZnF_C2H2 137 159 4.38e1 SMART
ZnF_C2H2 165 187 2.91e-2 SMART
ZnF_C2H2 193 215 2.36e-2 SMART
ZnF_C2H2 221 243 2.79e-4 SMART
PHD 222 283 4.64e0 SMART
ZnF_C2H2 249 271 4.47e-3 SMART
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 4.54e-4 SMART
ZnF_C2H2 333 355 8.94e-3 SMART
PHD 334 395 1.2e1 SMART
ZnF_C2H2 361 383 2.02e-1 SMART
ZnF_C2H2 389 411 2.75e-3 SMART
ZnF_C2H2 417 439 1.26e-2 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
PHD 446 507 1.12e0 SMART
ZnF_C2H2 473 495 4.79e-3 SMART
ZnF_C2H2 501 523 2.09e-3 SMART
ZnF_C2H2 529 551 2.95e-3 SMART
ZnF_C2H2 557 579 5.14e-3 SMART
ZnF_C2H2 585 607 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169142
AA Change: Y21C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129905
Gene: ENSMUSG00000057842
AA Change: Y21C

DomainStartEndE-ValueType
KRAB 5 65 1.57e-30 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 6.57e-1 SMART
ZnF_C2H2 137 159 4.38e1 SMART
ZnF_C2H2 165 187 2.91e-2 SMART
ZnF_C2H2 193 215 2.36e-2 SMART
ZnF_C2H2 221 243 2.79e-4 SMART
PHD 222 283 4.64e0 SMART
ZnF_C2H2 249 271 4.47e-3 SMART
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 4.54e-4 SMART
ZnF_C2H2 333 355 8.94e-3 SMART
PHD 334 395 1.2e1 SMART
ZnF_C2H2 361 383 2.02e-1 SMART
ZnF_C2H2 389 411 2.75e-3 SMART
ZnF_C2H2 417 439 1.26e-2 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
PHD 446 507 1.12e0 SMART
ZnF_C2H2 473 495 4.79e-3 SMART
ZnF_C2H2 501 523 2.09e-3 SMART
ZnF_C2H2 529 551 2.95e-3 SMART
ZnF_C2H2 557 579 5.14e-3 SMART
ZnF_C2H2 585 607 2.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170543
Predicted Effect probably benign
Transcript: ENSMUST00000171466
AA Change: Y18C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127010
Gene: ENSMUSG00000057842
AA Change: Y18C

DomainStartEndE-ValueType
KRAB 2 62 1.57e-30 SMART
ZnF_C2H2 78 100 2.09e-3 SMART
ZnF_C2H2 106 128 6.57e-1 SMART
ZnF_C2H2 134 156 4.38e1 SMART
ZnF_C2H2 162 184 2.91e-2 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 218 240 2.79e-4 SMART
PHD 219 280 4.64e0 SMART
ZnF_C2H2 246 268 4.47e-3 SMART
ZnF_C2H2 274 296 7.26e-3 SMART
ZnF_C2H2 302 324 4.54e-4 SMART
ZnF_C2H2 330 352 8.94e-3 SMART
PHD 331 392 1.2e1 SMART
ZnF_C2H2 358 380 2.02e-1 SMART
ZnF_C2H2 386 408 2.75e-3 SMART
ZnF_C2H2 414 436 1.26e-2 SMART
ZnF_C2H2 442 464 1.04e-3 SMART
PHD 443 504 1.12e0 SMART
ZnF_C2H2 470 492 4.79e-3 SMART
ZnF_C2H2 498 520 2.09e-3 SMART
ZnF_C2H2 526 548 2.95e-3 SMART
ZnF_C2H2 554 576 5.14e-3 SMART
ZnF_C2H2 582 604 2.95e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the Cys2His2 zinc finger protein family, whose members function as transcription factors that can regulate a broad variety of developmental and cellular processes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T G 13: 104,314,279 D323E possibly damaging Het
Ccdc125 T C 13: 100,690,319 V228A possibly damaging Het
Chrna2 A G 14: 66,150,993 I486V probably damaging Het
Cpxm1 T C 2: 130,393,573 T500A possibly damaging Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Cxcl1 T A 5: 90,891,595 probably null Het
Dab1 G A 4: 104,680,069 probably null Het
Ddx11 T A 17: 66,149,277 M751K probably damaging Het
Ece1 A G 4: 137,948,544 T410A probably benign Het
Eml5 C T 12: 98,865,494 V402I probably damaging Het
Fam241b A T 10: 62,108,856 *121R probably null Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Gpr149 A G 3: 62,595,022 V471A probably benign Het
Lemd3 A G 10: 120,947,251 S557P probably benign Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mmp7 T C 9: 7,697,692 Y243H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pak6 T C 2: 118,689,741 V71A probably damaging Het
Pira2 T A 7: 3,841,677 R452* probably null Het
Plxna1 A G 6: 89,356,976 S224P possibly damaging Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Prss12 A T 3: 123,505,327 T583S possibly damaging Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Rnf19a T A 15: 36,241,899 K665* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tbx15 T C 3: 99,352,154 I447T probably damaging Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Ugt1a9 T C 1: 88,070,840 V4A probably benign Het
Other mutations in Zfp595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Zfp595 APN 13 67316685 nonsense probably null
IGL01572:Zfp595 APN 13 67317401 missense possibly damaging 0.58
IGL01836:Zfp595 APN 13 67332461 utr 5 prime probably benign
IGL01924:Zfp595 APN 13 67317783 missense possibly damaging 0.93
IGL02171:Zfp595 APN 13 67316655 missense possibly damaging 0.61
IGL02376:Zfp595 APN 13 67316450 missense possibly damaging 0.80
IGL02651:Zfp595 APN 13 67320953 missense probably benign 0.00
R0071:Zfp595 UTSW 13 67316853 missense possibly damaging 0.55
R0111:Zfp595 UTSW 13 67320920 missense possibly damaging 0.90
R0319:Zfp595 UTSW 13 67316513 missense possibly damaging 0.92
R0491:Zfp595 UTSW 13 67317305 missense probably damaging 0.99
R1162:Zfp595 UTSW 13 67317195 missense probably damaging 1.00
R1559:Zfp595 UTSW 13 67317063 missense possibly damaging 0.93
R3901:Zfp595 UTSW 13 67317315 missense probably benign 0.13
R4738:Zfp595 UTSW 13 67317165 missense probably benign 0.11
R4866:Zfp595 UTSW 13 67317696 missense probably damaging 1.00
R4993:Zfp595 UTSW 13 67316401 missense probably damaging 0.99
R5987:Zfp595 UTSW 13 67317624 missense probably damaging 1.00
R6684:Zfp595 UTSW 13 67320277 missense probably damaging 1.00
R7099:Zfp595 UTSW 13 67317647 missense not run
Predicted Primers PCR Primer
(F):5'- TAAAAGTAGCCCTATGGTCACTGAT -3'
(R):5'- AGTTAATTGGGGTTATATCTATCCCAT -3'

Sequencing Primer
(F):5'- CACTGATTGACATAGAAACTTGCATG -3'
(R):5'- ATCATGACTATTGGAGACCTGTCC -3'
Posted On2015-02-05