Incidental Mutation 'R3120:Rlf'
ID263165
Institutional Source Beutler Lab
Gene Symbol Rlf
Ensembl Gene ENSMUSG00000049878
Gene Namerearranged L-myc fusion sequence
SynonymsMommeD8, 9230110M18Rik
MMRRC Submission 040593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3120 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location121145373-121215084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121149483 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 877 (I877L)
Ref Sequence ENSEMBL: ENSMUSP00000050825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056635] [ENSMUST00000168615]
Predicted Effect probably benign
Transcript: ENSMUST00000056635
AA Change: I877L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050825
Gene: ENSMUSG00000049878
AA Change: I877L

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
ZnF_C2H2 554 575 1.27e2 SMART
ZnF_C2H2 581 603 1.08e-1 SMART
ZnF_C2H2 667 692 5.42e-2 SMART
ZnF_C2H2 710 732 8.09e-1 SMART
ZnF_C2H2 738 762 3.99e0 SMART
ZnF_C2H2 767 791 3.16e-3 SMART
ZnF_C2H2 797 821 1.18e-2 SMART
low complexity region 885 909 N/A INTRINSIC
ZnF_C2H2 949 974 2.57e-3 SMART
low complexity region 1055 1066 N/A INTRINSIC
ZnF_C2H2 1122 1147 5.9e-3 SMART
ZnF_C2H2 1167 1190 4.17e-3 SMART
low complexity region 1259 1285 N/A INTRINSIC
ZnF_C2H2 1303 1328 5.06e-2 SMART
ZnF_C2H2 1355 1380 6.57e-1 SMART
ZnF_C2H2 1400 1425 3.83e-2 SMART
ZnF_C2H2 1437 1462 8.81e-2 SMART
low complexity region 1488 1514 N/A INTRINSIC
low complexity region 1521 1533 N/A INTRINSIC
ZnF_C2H2 1556 1581 4.81e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168615
AA Change: I767L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127068
Gene: ENSMUSG00000049878
AA Change: I767L

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 444 465 1.27e2 SMART
ZnF_C2H2 471 493 1.08e-1 SMART
ZnF_C2H2 557 582 5.42e-2 SMART
ZnF_C2H2 600 622 8.09e-1 SMART
ZnF_C2H2 628 652 3.99e0 SMART
ZnF_C2H2 657 681 3.16e-3 SMART
ZnF_C2H2 687 711 1.18e-2 SMART
low complexity region 775 799 N/A INTRINSIC
ZnF_C2H2 839 864 2.57e-3 SMART
low complexity region 945 956 N/A INTRINSIC
ZnF_C2H2 1012 1037 5.9e-3 SMART
ZnF_C2H2 1057 1080 4.17e-3 SMART
low complexity region 1149 1175 N/A INTRINSIC
ZnF_C2H2 1193 1218 5.06e-2 SMART
ZnF_C2H2 1245 1270 6.57e-1 SMART
ZnF_C2H2 1290 1315 3.83e-2 SMART
ZnF_C2H2 1327 1352 8.81e-2 SMART
low complexity region 1378 1404 N/A INTRINSIC
low complexity region 1411 1423 N/A INTRINSIC
ZnF_C2H2 1446 1471 4.81e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic ENU-induced allele exhibit postnatal lethality. Only a few mice survive to weaning age exhibiting a decreased body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bsx A G 9: 40,877,612 K155R possibly damaging Het
Ccdc39 T C 3: 33,837,838 K162E probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnah1 G A 14: 31,266,822 R3351* probably null Het
Eml1 A G 12: 108,513,053 R362G probably benign Het
Fam222b T C 11: 78,153,916 L101P probably damaging Het
Fars2 A G 13: 36,246,417 E276G probably damaging Het
Gatad1 G T 5: 3,641,456 Y33* probably null Het
Gclc A C 9: 77,781,270 E219A possibly damaging Het
Gm4846 A G 1: 166,491,548 V207A probably benign Het
Hbq1a T C 11: 32,300,472 L87P probably damaging Het
Hist1h1b A T 13: 21,780,045 S170R probably benign Het
Magea6 A T X: 154,924,295 I255N probably benign Het
Mfsd12 T G 10: 81,361,215 V206G probably benign Het
Mis18bp1 T C 12: 65,156,988 probably null Het
Nf1 C A 11: 79,564,899 T550K probably damaging Het
Nlrp4f T C 13: 65,194,716 T372A probably benign Het
Olfr495 T C 7: 108,395,723 I201T possibly damaging Het
Pkdcc T C 17: 83,220,037 Y215H probably damaging Het
Plekha5 A G 6: 140,591,641 T253A probably benign Het
Polr2f T A 15: 79,144,588 probably null Het
Prph2 C T 17: 46,923,372 A289V possibly damaging Het
Ptdss2 C T 7: 141,152,219 H140Y probably damaging Het
Scgb2b2 T C 7: 31,303,576 L32S possibly damaging Het
Sfpq T A 4: 127,022,133 H239Q unknown Het
St6gal2 A T 17: 55,482,110 R48S probably benign Het
Sybu T C 15: 44,672,959 D657G possibly damaging Het
Syt15 A G 14: 34,222,993 I166V probably benign Het
Taar7f C A 10: 24,049,580 T24K probably benign Het
Tbcd T C 11: 121,608,648 S1093P probably damaging Het
Tfap2c G A 2: 172,557,095 V396M possibly damaging Het
Tnxb C T 17: 34,692,355 T1544I possibly damaging Het
Trim28 A G 7: 13,028,414 T322A probably damaging Het
Tubgcp3 G A 8: 12,657,626 A121V possibly damaging Het
Vmn2r14 A T 5: 109,224,565 W20R probably null Het
Zfp551 A G 7: 12,416,016 F489L possibly damaging Het
Other mutations in Rlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rlf APN 4 121170686 missense possibly damaging 0.89
IGL00558:Rlf APN 4 121150973 missense probably damaging 1.00
IGL00990:Rlf APN 4 121148339 missense possibly damaging 0.87
IGL01625:Rlf APN 4 121188260 missense possibly damaging 0.68
IGL01921:Rlf APN 4 121146746 missense probably damaging 1.00
IGL01986:Rlf APN 4 121148106 missense probably damaging 1.00
IGL02232:Rlf APN 4 121182614 missense probably benign 0.21
IGL02586:Rlf APN 4 121150064 missense probably damaging 1.00
IGL03177:Rlf APN 4 121148079 nonsense probably null
IGL03233:Rlf APN 4 121182600 splice site probably benign
IGL03293:Rlf APN 4 121148330 missense probably benign 0.18
Brady UTSW 4 121148553 nonsense probably null
bunch UTSW 4 121154975 missense probably damaging 1.00
transsubstantiation UTSW 4 121148291 missense probably benign 0.10
wafer UTSW 4 121150532 missense probably benign 0.00
wine UTSW 4 121148172 missense probably damaging 1.00
PIT4651001:Rlf UTSW 4 121150313 missense probably damaging 0.98
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0019:Rlf UTSW 4 121146572 missense possibly damaging 0.46
R0039:Rlf UTSW 4 121146842 missense possibly damaging 0.90
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0041:Rlf UTSW 4 121149929 missense probably damaging 1.00
R0590:Rlf UTSW 4 121170833 splice site probably benign
R1562:Rlf UTSW 4 121150391 missense possibly damaging 0.47
R1585:Rlf UTSW 4 121148291 missense probably benign 0.10
R1627:Rlf UTSW 4 121150000 missense probably benign 0.34
R1709:Rlf UTSW 4 121149823 missense probably benign 0.00
R1968:Rlf UTSW 4 121148420 missense probably damaging 1.00
R1982:Rlf UTSW 4 121150112 missense probably damaging 1.00
R3155:Rlf UTSW 4 121149332 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3162:Rlf UTSW 4 121148847 missense probably damaging 1.00
R3429:Rlf UTSW 4 121150532 missense probably benign 0.00
R3430:Rlf UTSW 4 121150532 missense probably benign 0.00
R3700:Rlf UTSW 4 121150863 missense possibly damaging 0.77
R3732:Rlf UTSW 4 121148324 missense probably benign
R3909:Rlf UTSW 4 121149032 missense probably benign 0.00
R4033:Rlf UTSW 4 121147343 missense probably damaging 1.00
R4350:Rlf UTSW 4 121149096 missense probably benign 0.16
R4654:Rlf UTSW 4 121150601 missense probably benign 0.28
R4976:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5060:Rlf UTSW 4 121146866 missense probably benign 0.00
R5105:Rlf UTSW 4 121150367 missense probably damaging 1.00
R5119:Rlf UTSW 4 121147455 missense probably damaging 0.98
R5150:Rlf UTSW 4 121148172 missense probably damaging 1.00
R5198:Rlf UTSW 4 121148553 nonsense probably null
R5214:Rlf UTSW 4 121150700 missense probably damaging 1.00
R6084:Rlf UTSW 4 121149215 missense possibly damaging 0.95
R6131:Rlf UTSW 4 121154975 missense probably damaging 1.00
R6188:Rlf UTSW 4 121170766 missense probably damaging 1.00
R6313:Rlf UTSW 4 121148610 missense probably damaging 0.99
R6332:Rlf UTSW 4 121148822 missense possibly damaging 0.75
R6341:Rlf UTSW 4 121149360 nonsense probably null
R6413:Rlf UTSW 4 121147325 missense probably damaging 1.00
R6683:Rlf UTSW 4 121147926 missense probably damaging 1.00
R7066:Rlf UTSW 4 121148787 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCGTCAAAACCACAGGTG -3'
(R):5'- CACCTCTCCATGCATAATGTTG -3'

Sequencing Primer
(F):5'- AGCCACATTGGAGCACTTGTC -3'
(R):5'- CCTCTCCATGCATAATGTTGAAAGTC -3'
Posted On2015-02-05