Incidental Mutation 'R3120:Sfpq'
ID263166
Institutional Source Beutler Lab
Gene Symbol Sfpq
Ensembl Gene ENSMUSG00000028820
Gene Namesplicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms2810416M14Rik, PSF, 1110004P21Rik, 5730453G22Rik, REP1, D4Ertd314e, 9030402K04Rik
MMRRC Submission 040593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3120 (G1)
Quality Score158
Status Not validated
Chromosome4
Chromosomal Location127021324-127037013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127022133 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 239 (H239Q)
Ref Sequence ENSEMBL: ENSMUSP00000030623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030623]
Predicted Effect unknown
Transcript: ENSMUST00000030623
AA Change: H239Q
SMART Domains Protein: ENSMUSP00000030623
Gene: ENSMUSG00000028820
AA Change: H239Q

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 48 101 N/A INTRINSIC
low complexity region 105 236 N/A INTRINSIC
low complexity region 238 258 N/A INTRINSIC
RRM 290 357 3.97e-18 SMART
RRM 364 440 3.83e-11 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 554 587 N/A INTRINSIC
low complexity region 595 614 N/A INTRINSIC
low complexity region 617 639 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 682 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146285
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele die. Heterozygous mice show abnormality in entrainment of circadian rhythm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bsx A G 9: 40,877,612 K155R possibly damaging Het
Ccdc39 T C 3: 33,837,838 K162E probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnah1 G A 14: 31,266,822 R3351* probably null Het
Eml1 A G 12: 108,513,053 R362G probably benign Het
Fam222b T C 11: 78,153,916 L101P probably damaging Het
Fars2 A G 13: 36,246,417 E276G probably damaging Het
Gatad1 G T 5: 3,641,456 Y33* probably null Het
Gclc A C 9: 77,781,270 E219A possibly damaging Het
Gm4846 A G 1: 166,491,548 V207A probably benign Het
Hbq1a T C 11: 32,300,472 L87P probably damaging Het
Hist1h1b A T 13: 21,780,045 S170R probably benign Het
Magea6 A T X: 154,924,295 I255N probably benign Het
Mfsd12 T G 10: 81,361,215 V206G probably benign Het
Mis18bp1 T C 12: 65,156,988 probably null Het
Nf1 C A 11: 79,564,899 T550K probably damaging Het
Nlrp4f T C 13: 65,194,716 T372A probably benign Het
Olfr495 T C 7: 108,395,723 I201T possibly damaging Het
Pkdcc T C 17: 83,220,037 Y215H probably damaging Het
Plekha5 A G 6: 140,591,641 T253A probably benign Het
Polr2f T A 15: 79,144,588 probably null Het
Prph2 C T 17: 46,923,372 A289V possibly damaging Het
Ptdss2 C T 7: 141,152,219 H140Y probably damaging Het
Rlf T A 4: 121,149,483 I877L probably benign Het
Scgb2b2 T C 7: 31,303,576 L32S possibly damaging Het
St6gal2 A T 17: 55,482,110 R48S probably benign Het
Sybu T C 15: 44,672,959 D657G possibly damaging Het
Syt15 A G 14: 34,222,993 I166V probably benign Het
Taar7f C A 10: 24,049,580 T24K probably benign Het
Tbcd T C 11: 121,608,648 S1093P probably damaging Het
Tfap2c G A 2: 172,557,095 V396M possibly damaging Het
Tnxb C T 17: 34,692,355 T1544I possibly damaging Het
Trim28 A G 7: 13,028,414 T322A probably damaging Het
Tubgcp3 G A 8: 12,657,626 A121V possibly damaging Het
Vmn2r14 A T 5: 109,224,565 W20R probably null Het
Zfp551 A G 7: 12,416,016 F489L possibly damaging Het
Other mutations in Sfpq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Sfpq APN 4 127023688 missense possibly damaging 0.80
IGL00578:Sfpq APN 4 127025907 missense probably damaging 1.00
IGL01301:Sfpq APN 4 127026760 splice site probably benign
IGL02385:Sfpq APN 4 127026136 splice site probably null
IGL03373:Sfpq APN 4 127026785 missense possibly damaging 0.92
R0645:Sfpq UTSW 4 127022969 missense possibly damaging 0.75
R2038:Sfpq UTSW 4 127021502 missense unknown
R4609:Sfpq UTSW 4 127021611 missense unknown
R4788:Sfpq UTSW 4 127025998 missense probably damaging 1.00
R5034:Sfpq UTSW 4 127023669 splice site probably benign
R5411:Sfpq UTSW 4 127021723 missense unknown
R6115:Sfpq UTSW 4 127021348 start gained probably null
R6906:Sfpq UTSW 4 127021626 small deletion probably benign
R6907:Sfpq UTSW 4 127021626 small deletion probably benign
R6908:Sfpq UTSW 4 127021626 small deletion probably benign
R6929:Sfpq UTSW 4 127021626 small deletion probably benign
R6933:Sfpq UTSW 4 127021626 small deletion probably benign
R7029:Sfpq UTSW 4 127029882 missense probably benign 0.23
R7124:Sfpq UTSW 4 127025932 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGGAATCCAAGCCCGTCGT -3'
(R):5'- CAAAATGGAGGCCCTCTAGG -3'

Sequencing Primer
(F):5'- AGCAGCGGAGTCTCGAC -3'
(R):5'- CCCTCTAGGCTGCGGGC -3'
Posted On2015-02-05