Incidental Mutation 'R3120:St6gal2'
ID263199
Institutional Source Beutler Lab
Gene Symbol St6gal2
Ensembl Gene ENSMUSG00000024172
Gene Namebeta galactoside alpha 2,6 sialyltransferase 2
SynonymsST6Gal II, C230064G14Rik
MMRRC Submission 040593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3120 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55445382-55514581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55482110 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 48 (R48S)
Ref Sequence ENSEMBL: ENSMUSP00000120762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025000] [ENSMUST00000086878] [ENSMUST00000133899]
Predicted Effect probably benign
Transcript: ENSMUST00000025000
AA Change: R48S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025000
Gene: ENSMUSG00000024172
AA Change: R48S

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 251 257 N/A INTRINSIC
Pfam:Glyco_transf_29 272 501 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086878
AA Change: R48S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084091
Gene: ENSMUSG00000024172
AA Change: R48S

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 234 438 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133899
AA Change: R48S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120762
Gene: ENSMUSG00000024172
AA Change: R48S

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 207 316 5.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153220
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sialyltransferase. The encoded type II transmembrane protein catalyzes the transfer of sialic acid from CMP to an oligosaccharide substrate. Polymorphisms at this locus may be associated with variations in risperidone response in schizophrenic patients. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bsx A G 9: 40,877,612 K155R possibly damaging Het
Ccdc39 T C 3: 33,837,838 K162E probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnah1 G A 14: 31,266,822 R3351* probably null Het
Eml1 A G 12: 108,513,053 R362G probably benign Het
Fam222b T C 11: 78,153,916 L101P probably damaging Het
Fars2 A G 13: 36,246,417 E276G probably damaging Het
Gatad1 G T 5: 3,641,456 Y33* probably null Het
Gclc A C 9: 77,781,270 E219A possibly damaging Het
Gm4846 A G 1: 166,491,548 V207A probably benign Het
Hbq1a T C 11: 32,300,472 L87P probably damaging Het
Hist1h1b A T 13: 21,780,045 S170R probably benign Het
Magea6 A T X: 154,924,295 I255N probably benign Het
Mfsd12 T G 10: 81,361,215 V206G probably benign Het
Mis18bp1 T C 12: 65,156,988 probably null Het
Nf1 C A 11: 79,564,899 T550K probably damaging Het
Nlrp4f T C 13: 65,194,716 T372A probably benign Het
Olfr495 T C 7: 108,395,723 I201T possibly damaging Het
Pkdcc T C 17: 83,220,037 Y215H probably damaging Het
Plekha5 A G 6: 140,591,641 T253A probably benign Het
Polr2f T A 15: 79,144,588 probably null Het
Prph2 C T 17: 46,923,372 A289V possibly damaging Het
Ptdss2 C T 7: 141,152,219 H140Y probably damaging Het
Rlf T A 4: 121,149,483 I877L probably benign Het
Scgb2b2 T C 7: 31,303,576 L32S possibly damaging Het
Sfpq T A 4: 127,022,133 H239Q unknown Het
Sybu T C 15: 44,672,959 D657G possibly damaging Het
Syt15 A G 14: 34,222,993 I166V probably benign Het
Taar7f C A 10: 24,049,580 T24K probably benign Het
Tbcd T C 11: 121,608,648 S1093P probably damaging Het
Tfap2c G A 2: 172,557,095 V396M possibly damaging Het
Tnxb C T 17: 34,692,355 T1544I possibly damaging Het
Trim28 A G 7: 13,028,414 T322A probably damaging Het
Tubgcp3 G A 8: 12,657,626 A121V possibly damaging Het
Vmn2r14 A T 5: 109,224,565 W20R probably null Het
Zfp551 A G 7: 12,416,016 F489L possibly damaging Het
Other mutations in St6gal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:St6gal2 APN 17 55482595 missense probably damaging 1.00
R0496:St6gal2 UTSW 17 55482014 missense probably damaging 0.96
R0652:St6gal2 UTSW 17 55498289 missense probably benign
R1456:St6gal2 UTSW 17 55490931 splice site probably benign
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1676:St6gal2 UTSW 17 55496395 critical splice donor site probably null
R2092:St6gal2 UTSW 17 55510266 missense probably damaging 1.00
R3875:St6gal2 UTSW 17 55482697 missense probably benign 0.02
R3928:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R3929:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R4512:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4513:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4514:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4564:St6gal2 UTSW 17 55482647 missense probably damaging 1.00
R4701:St6gal2 UTSW 17 55496344 missense probably damaging 1.00
R4716:St6gal2 UTSW 17 55510366 missense probably benign 0.01
R6034:St6gal2 UTSW 17 55482981 missense probably benign
R6034:St6gal2 UTSW 17 55482981 missense probably benign
R6356:St6gal2 UTSW 17 55482013 missense probably damaging 1.00
R6455:St6gal2 UTSW 17 55482513 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTGCTGGCCCCAAAGATC -3'
(R):5'- GATAGAAAGCGCTTTGTGATTTCC -3'

Sequencing Primer
(F):5'- TGGCCCCAAAGATCTGCAATG -3'
(R):5'- CCCATTGTCAAAGCCATTTGGGG -3'
Posted On2015-02-05