Incidental Mutation 'R3121:Wapl'
ID263247
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission 040594-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3121 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34729215 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 729 (I729M)
Ref Sequence ENSEMBL: ENSMUSP00000087481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: I735M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: I735M

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090027
AA Change: I729M

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: I729M

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect unknown
Transcript: ENSMUST00000151285
AA Change: I19M
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: I19M

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: I735M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: I735M

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172658
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik A T X: 51,969,091 Y239* probably null Het
2310035C23Rik A G 1: 105,725,799 N834S probably benign Het
2810403A07Rik A G 3: 88,689,292 T127A probably damaging Het
2810474O19Rik T A 6: 149,329,243 C1262* probably null Het
Abcg5 A T 17: 84,658,663 M423K probably benign Het
Adamtsl1 T A 4: 86,337,009 W780R probably damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Amph T A 13: 19,113,146 L354* probably null Het
Ankk1 G A 9: 49,426,967 L9F probably benign Het
BC080695 T A 4: 143,571,013 M1K probably null Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Bzw2 A C 12: 36,120,789 probably null Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc50 G T 16: 27,409,389 R102L possibly damaging Het
Cep83 T C 10: 94,786,838 V592A probably damaging Het
Cgn G A 3: 94,778,482 probably benign Het
Cidec C A 6: 113,428,125 V195L probably benign Het
Cntln A G 4: 85,005,052 probably benign Het
Cntrob A T 11: 69,322,700 L88* probably null Het
Dnah17 C T 11: 118,041,086 V3687M probably damaging Het
Dst T C 1: 34,289,648 I4599T probably damaging Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Fam98b A G 2: 117,267,927 T293A probably damaging Het
Farp1 G A 14: 121,222,726 probably benign Het
Fat2 G T 11: 55,311,796 P151T probably damaging Het
Fbxl17 A T 17: 63,471,424 M497K probably damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm525 C T 11: 89,088,548 probably benign Het
Golga4 C A 9: 118,557,380 T1190K possibly damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Homez T C 14: 54,857,321 E310G probably benign Het
Hydin A G 8: 110,506,506 I1746V probably benign Het
Igkv1-35 T A 6: 70,011,657 H6L probably benign Het
Kcnt2 T C 1: 140,428,884 S354P probably damaging Het
Klra4 G T 6: 130,063,178 Q44K probably benign Het
L3mbtl3 A G 10: 26,344,221 probably benign Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Map3k9 A G 12: 81,743,924 I285T probably damaging Het
Olfr1256 T A 2: 89,835,514 I144L probably benign Het
Olfr782 A G 10: 129,350,683 N40S possibly damaging Het
Pcdhb16 A T 18: 37,478,218 Q77L possibly damaging Het
Proser3 A G 7: 30,540,371 V436A probably benign Het
Sec24b C T 3: 130,002,304 probably null Het
Slc2a2 A G 3: 28,721,749 Q336R probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Spidr T C 16: 16,140,860 K13E probably damaging Het
Tiam2 T A 17: 3,439,702 M786K probably benign Het
Tktl2 T A 8: 66,512,156 V122E probably damaging Het
Zbbx T C 3: 75,081,846 T317A possibly damaging Het
Zfp976 A G 7: 42,613,514 C300R probably damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTTCAAAGAAATGGGTAGCG -3'
(R):5'- TTGTTGTGCACAGTTTCACAG -3'

Sequencing Primer
(F):5'- CAAATAGCTATGTTTCCCTAGGC -3'
(R):5'- GCACAGTTTCACAGAGTCTTCGG -3'
Posted On2015-02-05