Incidental Mutation 'R3121:H2-T23'
ID263256
Institutional Source Beutler Lab
Gene Symbol H2-T23
Ensembl Gene ENSMUSG00000067212
Gene Namehistocompatibility 2, T region locus 23
Synonyms37b, T18c(37), 37c, Qa-1, Qed-1, T23b, T18c, T23d, H-2T23, Qa1
MMRRC Submission 040594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3121 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36029773-36032855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36030963 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 248 (M248L)
Ref Sequence ENSEMBL: ENSMUSP00000099739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102678]
PDB Structure
Structure of the MHC class Ib molecule Qa-1b [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000102678
AA Change: M248L

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099739
Gene: ENSMUSG00000067212
AA Change: M248L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 21 199 1.9e-93 PFAM
IGc1 218 289 1.89e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174839
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: CD4+ T cells from mice with a homozygous null mutation have enhanced responses after infection or immunization, are resistant to suppressor activity mediated by a subset of CD8+ T cells, but are more susceptible to NK cell lysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik A T X: 51,969,091 Y239* probably null Het
2310035C23Rik A G 1: 105,725,799 N834S probably benign Het
2810403A07Rik A G 3: 88,689,292 T127A probably damaging Het
2810474O19Rik T A 6: 149,329,243 C1262* probably null Het
Abcg5 A T 17: 84,658,663 M423K probably benign Het
Adamtsl1 T A 4: 86,337,009 W780R probably damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Amph T A 13: 19,113,146 L354* probably null Het
Ankk1 G A 9: 49,426,967 L9F probably benign Het
BC080695 T A 4: 143,571,013 M1K probably null Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Bzw2 A C 12: 36,120,789 probably null Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc50 G T 16: 27,409,389 R102L possibly damaging Het
Cep83 T C 10: 94,786,838 V592A probably damaging Het
Cgn G A 3: 94,778,482 probably benign Het
Cidec C A 6: 113,428,125 V195L probably benign Het
Cntln A G 4: 85,005,052 probably benign Het
Cntrob A T 11: 69,322,700 L88* probably null Het
Dnah17 C T 11: 118,041,086 V3687M probably damaging Het
Dst T C 1: 34,289,648 I4599T probably damaging Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Fam98b A G 2: 117,267,927 T293A probably damaging Het
Farp1 G A 14: 121,222,726 probably benign Het
Fat2 G T 11: 55,311,796 P151T probably damaging Het
Fbxl17 A T 17: 63,471,424 M497K probably damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm525 C T 11: 89,088,548 probably benign Het
Golga4 C A 9: 118,557,380 T1190K possibly damaging Het
Homez T C 14: 54,857,321 E310G probably benign Het
Hydin A G 8: 110,506,506 I1746V probably benign Het
Igkv1-35 T A 6: 70,011,657 H6L probably benign Het
Kcnt2 T C 1: 140,428,884 S354P probably damaging Het
Klra4 G T 6: 130,063,178 Q44K probably benign Het
L3mbtl3 A G 10: 26,344,221 probably benign Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Map3k9 A G 12: 81,743,924 I285T probably damaging Het
Olfr1256 T A 2: 89,835,514 I144L probably benign Het
Olfr782 A G 10: 129,350,683 N40S possibly damaging Het
Pcdhb16 A T 18: 37,478,218 Q77L possibly damaging Het
Proser3 A G 7: 30,540,371 V436A probably benign Het
Sec24b C T 3: 130,002,304 probably null Het
Slc2a2 A G 3: 28,721,749 Q336R probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Spidr T C 16: 16,140,860 K13E probably damaging Het
Tiam2 T A 17: 3,439,702 M786K probably benign Het
Tktl2 T A 8: 66,512,156 V122E probably damaging Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Zbbx T C 3: 75,081,846 T317A possibly damaging Het
Zfp976 A G 7: 42,613,514 C300R probably damaging Het
Other mutations in H2-T23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:H2-T23 APN 17 36031781 missense probably damaging 1.00
IGL01685:H2-T23 APN 17 36032644 missense probably benign 0.29
IGL02756:H2-T23 APN 17 36031688 missense probably damaging 1.00
IGL03036:H2-T23 APN 17 36032357 missense possibly damaging 0.73
LCD18:H2-T23 UTSW 17 36031216 intron probably benign
R0539:H2-T23 UTSW 17 36032141 splice site probably benign
R0845:H2-T23 UTSW 17 36030583 missense probably benign 0.00
R1727:H2-T23 UTSW 17 36031653 missense possibly damaging 0.52
R2044:H2-T23 UTSW 17 36032191 missense probably damaging 1.00
R3122:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3943:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R3944:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R4492:H2-T23 UTSW 17 36032166 missense probably damaging 0.97
R4660:H2-T23 UTSW 17 36030216 missense probably damaging 0.99
R4669:H2-T23 UTSW 17 36031798 missense probably damaging 1.00
R4740:H2-T23 UTSW 17 36032124 intron probably benign
R5151:H2-T23 UTSW 17 36032338 missense probably damaging 1.00
R5196:H2-T23 UTSW 17 36032607 critical splice donor site probably null
R5237:H2-T23 UTSW 17 36030366 splice site probably null
R5307:H2-T23 UTSW 17 36032216 missense probably benign 0.00
R5336:H2-T23 UTSW 17 36031658 missense possibly damaging 0.85
R5646:H2-T23 UTSW 17 36031803 missense possibly damaging 0.49
R5800:H2-T23 UTSW 17 36031604 intron probably benign
R6013:H2-T23 UTSW 17 36030582 missense probably benign 0.00
R6081:H2-T23 UTSW 17 36031815 missense possibly damaging 0.90
R6382:H2-T23 UTSW 17 36031832 missense probably damaging 1.00
R7043:H2-T23 UTSW 17 36031911 missense probably damaging 1.00
R7134:H2-T23 UTSW 17 36031817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGATCCCAGCTCTGAGCC -3'
(R):5'- GCAAGATGCCTCATCCTTTCAAC -3'

Sequencing Primer
(F):5'- CCAACTCAGGGTCTGCAGAAG -3'
(R):5'- AGATGCCTCATCCTTTCAACTCTCTC -3'
Posted On2015-02-05