Mutagenetix > Incidental Mutation

Incidental Mutation 'R3033:Astn2'

263338

Institutional Source

Beutler Lab

Gene Symbol

Astn2

Ensembl Gene

ENSMUSG00000028373

Gene Name

astrotactin 2

Synonyms

1d8, Astnl

MMRRC Submission

040549-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R3033 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65299040-66322774 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65562943 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 894 (Y894C)

Ref Sequence

ENSEMBL: ENSMUSP00000081540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]

AlphaFold

Q80Z10

Predicted Effect

probably damaging
Transcript: ENSMUST00000068214
AA Change: Y946C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: Y946C

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	342	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	432	437	N/A	INTRINSIC
transmembrane domain	443	465	N/A	INTRINSIC
EGF_like	526	563	2.92e1	SMART
Blast:EGF_like	667	708	2e-18	BLAST
EGF_like	715	764	4.03e1	SMART
MACPF	864	1048	2.88e-55	SMART
FN3	1079	1191	2.41e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000084496
AA Change: Y894C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: Y894C

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	341	352	N/A	INTRINSIC
low complexity region	380	385	N/A	INTRINSIC
transmembrane domain	391	413	N/A	INTRINSIC
EGF_like	474	511	2.92e1	SMART
Blast:EGF_like	615	656	2e-18	BLAST
EGF_like	663	712	4.03e1	SMART
MACPF	812	996	2.88e-55	SMART
FN3	1027	1139	2.41e0	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam3	T	C	8: 25,184,227 (GRCm39)	D591G	probably benign	Het
Aqp4	T	A	18: 15,526,617 (GRCm39)	E288V	possibly damaging	Het
Bahd1	C	T	2: 118,746,887 (GRCm39)	P169S	probably damaging	Het
Dennd4c	AGGAGCTCCTGGAGC	AGGAGC	4: 86,743,557 (GRCm39)		probably benign	Het
Dnah6	T	C	6: 73,150,333 (GRCm39)	D810G	probably benign	Het
Dst	T	C	1: 34,191,366 (GRCm39)	I222T	probably damaging	Het
Eif4g3	A	T	4: 137,830,721 (GRCm39)	T159S	probably damaging	Het
Ercc5	A	G	1: 44,219,734 (GRCm39)	E1002G	possibly damaging	Het
Gm5414	T	C	15: 101,533,044 (GRCm39)	E461G	probably damaging	Het
Heatr5a	A	T	12: 51,997,821 (GRCm39)	C359*	probably null	Het
Ift88	G	A	14: 57,715,501 (GRCm39)	D515N	probably damaging	Het
Kmt2a	A	G	9: 44,733,160 (GRCm39)		probably benign	Het
Lypd8	T	C	11: 58,275,453 (GRCm39)	Y63H	probably damaging	Het
Mcm3	A	T	1: 20,878,992 (GRCm39)	Y594N	probably damaging	Het
Myo9b	G	A	8: 71,786,981 (GRCm39)	R721Q	probably benign	Het
Naip1	T	C	13: 100,568,966 (GRCm39)	M322V	probably benign	Het
Neurl2	T	C	2: 164,674,975 (GRCm39)	E129G	probably benign	Het
Nr2f2	A	G	7: 70,007,810 (GRCm39)	V71A	possibly damaging	Het
Rab36	G	A	10: 74,880,328 (GRCm39)	V63I	probably damaging	Het
Rap1gap2	C	A	11: 74,298,148 (GRCm39)	A491S	possibly damaging	Het
Rapgef2	A	G	3: 78,981,613 (GRCm39)		probably null	Het
Selenbp1	T	C	3: 94,845,351 (GRCm39)	V149A	probably benign	Het
Smg9	A	G	7: 24,115,949 (GRCm39)	D280G	probably damaging	Het
Tlr1	T	C	5: 65,082,912 (GRCm39)	D555G	probably damaging	Het
Tomm70a	G	A	16: 56,942,388 (GRCm39)	G55D	probably damaging	Het
Tpte	T	A	8: 22,810,888 (GRCm39)	S182T	possibly damaging	Het
Zfp58	T	C	13: 67,639,741 (GRCm39)	E250G	probably damaging	Het

Other mutations in Astn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Astn2	APN	4	66,103,424 (GRCm39)	missense	unknown
IGL01657:Astn2	APN	4	65,570,186 (GRCm39)	missense	probably damaging	0.99
IGL01747:Astn2	APN	4	65,712,855 (GRCm39)	missense	probably benign	0.17
IGL02008:Astn2	APN	4	65,977,390 (GRCm39)	missense	probably damaging	1.00
IGL02215:Astn2	APN	4	66,184,471 (GRCm39)	missense	unknown
IGL02484:Astn2	APN	4	65,910,516 (GRCm39)	splice site	probably benign
IGL02494:Astn2	APN	4	65,910,585 (GRCm39)	missense	probably benign	0.23
IGL02792:Astn2	APN	4	65,563,058 (GRCm39)	missense	probably benign	0.32
IGL03248:Astn2	APN	4	65,664,530 (GRCm39)	splice site	probably benign
IGL03409:Astn2	APN	4	65,353,423 (GRCm39)	missense	possibly damaging	0.46
B6584:Astn2	UTSW	4	65,910,624 (GRCm39)	missense	probably damaging	0.99
R0015:Astn2	UTSW	4	66,184,619 (GRCm39)	critical splice acceptor site	probably null
R0015:Astn2	UTSW	4	66,184,619 (GRCm39)	critical splice acceptor site	probably null
R0092:Astn2	UTSW	4	66,322,219 (GRCm39)	missense	unknown
R0245:Astn2	UTSW	4	65,712,795 (GRCm39)	missense	probably damaging	0.99
R0528:Astn2	UTSW	4	65,563,119 (GRCm39)	splice site	probably benign
R0586:Astn2	UTSW	4	66,103,379 (GRCm39)	missense	unknown
R0652:Astn2	UTSW	4	65,712,795 (GRCm39)	missense	probably damaging	0.99
R0880:Astn2	UTSW	4	65,566,567 (GRCm39)	missense	probably damaging	0.99
R0931:Astn2	UTSW	4	65,566,530 (GRCm39)	missense	probably damaging	0.99
R1353:Astn2	UTSW	4	66,184,572 (GRCm39)	missense	unknown
R1700:Astn2	UTSW	4	65,664,591 (GRCm39)	nonsense	probably null
R1934:Astn2	UTSW	4	65,353,426 (GRCm39)	missense	probably damaging	0.99
R2017:Astn2	UTSW	4	65,459,178 (GRCm39)	missense	probably damaging	0.99
R2101:Astn2	UTSW	4	65,499,923 (GRCm39)	nonsense	probably null
R2158:Astn2	UTSW	4	66,322,491 (GRCm39)	missense	unknown
R2907:Astn2	UTSW	4	65,563,093 (GRCm39)	missense	possibly damaging	0.92
R2923:Astn2	UTSW	4	65,832,010 (GRCm39)	missense	probably damaging	1.00
R2938:Astn2	UTSW	4	65,910,550 (GRCm39)	missense	possibly damaging	0.92
R3933:Astn2	UTSW	4	66,322,192 (GRCm39)	missense	unknown
R4151:Astn2	UTSW	4	65,647,557 (GRCm39)	critical splice donor site	probably null
R4230:Astn2	UTSW	4	65,829,919 (GRCm39)	missense	probably damaging	0.99
R4497:Astn2	UTSW	4	66,037,300 (GRCm39)	intron	probably benign
R4717:Astn2	UTSW	4	65,562,991 (GRCm39)	missense	possibly damaging	0.86
R4844:Astn2	UTSW	4	65,562,967 (GRCm39)	missense	possibly damaging	0.90
R4928:Astn2	UTSW	4	65,647,644 (GRCm39)	missense	probably damaging	0.98
R5374:Astn2	UTSW	4	65,315,242 (GRCm39)	missense	probably damaging	0.96
R5442:Astn2	UTSW	4	65,500,023 (GRCm39)	missense	possibly damaging	0.86
R5694:Astn2	UTSW	4	65,868,375 (GRCm39)	missense	probably damaging	1.00
R5756:Astn2	UTSW	4	66,037,425 (GRCm39)	intron	probably benign
R5763:Astn2	UTSW	4	65,647,568 (GRCm39)	missense	probably benign	0.14
R6089:Astn2	UTSW	4	65,712,810 (GRCm39)	missense	probably damaging	0.96
R6990:Astn2	UTSW	4	65,910,540 (GRCm39)	missense	possibly damaging	0.82
R7304:Astn2	UTSW	4	66,103,612 (GRCm39)	missense	unknown
R7325:Astn2	UTSW	4	65,460,906 (GRCm39)	missense	probably benign	0.33
R7356:Astn2	UTSW	4	66,103,503 (GRCm39)	missense	unknown
R7414:Astn2	UTSW	4	65,459,193 (GRCm39)	missense	possibly damaging	0.85
R7755:Astn2	UTSW	4	65,712,795 (GRCm39)	missense	probably damaging	0.99
R7887:Astn2	UTSW	4	65,563,103 (GRCm39)	missense	possibly damaging	0.51
R8027:Astn2	UTSW	4	65,459,208 (GRCm39)	missense	possibly damaging	0.86
R8046:Astn2	UTSW	4	66,184,587 (GRCm39)	nonsense	probably null
R8188:Astn2	UTSW	4	65,977,418 (GRCm39)	missense	unknown
R8271:Astn2	UTSW	4	65,910,663 (GRCm39)	missense	unknown
R8274:Astn2	UTSW	4	65,570,098 (GRCm39)	critical splice donor site	probably null
R8505:Astn2	UTSW	4	65,299,825 (GRCm39)	missense	unknown
R8815:Astn2	UTSW	4	65,830,834 (GRCm39)	missense	possibly damaging	0.96
R8989:Astn2	UTSW	4	65,499,890 (GRCm39)	missense	possibly damaging	0.53
R9013:Astn2	UTSW	4	65,910,584 (GRCm39)	missense	probably benign	0.23
R9127:Astn2	UTSW	4	66,322,164 (GRCm39)	missense	unknown
R9255:Astn2	UTSW	4	65,563,085 (GRCm39)	nonsense	probably null
R9297:Astn2	UTSW	4	65,460,960 (GRCm39)	missense	possibly damaging	0.85
R9320:Astn2	UTSW	4	66,322,386 (GRCm39)	missense	unknown
R9349:Astn2	UTSW	4	66,184,492 (GRCm39)	missense	unknown
R9399:Astn2	UTSW	4	65,664,588 (GRCm39)	missense	possibly damaging	0.71
R9572:Astn2	UTSW	4	65,299,872 (GRCm39)	missense	unknown
R9573:Astn2	UTSW	4	65,566,591 (GRCm39)	missense	probably benign	0.08
R9674:Astn2	UTSW	4	65,460,963 (GRCm39)	missense	probably damaging	0.98
R9722:Astn2	UTSW	4	65,831,978 (GRCm39)	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GGCAGCATGTTCTCTCACCTTG -3'
(R):5'- GGCCACCAACTTCTGATGTC -3'

Sequencing Primer
(F):5'- CTTGACCATCATGAAGCGAAG -3'
(R):5'- GATGTCTAAGCACTTACACACGTTC -3'

Posted On

2015-02-05