Incidental Mutation 'R3033:Tpte'
ID263345
Institutional Source Beutler Lab
Gene Symbol Tpte
Ensembl Gene ENSMUSG00000031481
Gene Nametransmembrane phosphatase with tensin homology
SynonymsPten2
MMRRC Submission 040549-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3033 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22283441-22371418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22320872 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 182 (S182T)
Ref Sequence ENSEMBL: ENSMUSP00000076435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077194] [ENSMUST00000211497] [ENSMUST00000211747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077194
AA Change: S182T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076435
Gene: ENSMUSG00000031481
AA Change: S182T

DomainStartEndE-ValueType
low complexity region 146 167 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 246 265 N/A INTRINSIC
transmembrane domain 277 299 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
Pfam:Y_phosphatase 369 511 1.4e-6 PFAM
Pfam:DSPc 384 505 7.3e-8 PFAM
PTEN_C2 529 663 3.72e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211497
Predicted Effect probably benign
Transcript: ENSMUST00000211747
AA Change: S182T

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,694,211 D591G probably benign Het
Aqp4 T A 18: 15,393,560 E288V possibly damaging Het
Astn2 T C 4: 65,644,706 Y894C probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Dennd4c AGGAGCTCCTGGAGC AGGAGC 4: 86,825,320 probably benign Het
Dnah6 T C 6: 73,173,350 D810G probably benign Het
Dst T C 1: 34,152,285 I222T probably damaging Het
Eif4g3 A T 4: 138,103,410 T159S probably damaging Het
Ercc5 A G 1: 44,180,574 E1002G possibly damaging Het
Gm5414 T C 15: 101,624,609 E461G probably damaging Het
Heatr5a A T 12: 51,951,038 C359* probably null Het
Ift88 G A 14: 57,478,044 D515N probably damaging Het
Kmt2a A G 9: 44,821,863 probably benign Het
Lypd8 T C 11: 58,384,627 Y63H probably damaging Het
Mcm3 A T 1: 20,808,768 Y594N probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Naip1 T C 13: 100,432,458 M322V probably benign Het
Neurl2 T C 2: 164,833,055 E129G probably benign Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rapgef2 A G 3: 79,074,306 probably null Het
Selenbp1 T C 3: 94,938,040 V149A probably benign Het
Smg9 A G 7: 24,416,524 D280G probably damaging Het
Tlr1 T C 5: 64,925,569 D555G probably damaging Het
Tomm70a G A 16: 57,122,025 G55D probably damaging Het
Zfp58 T C 13: 67,491,622 E250G probably damaging Het
Other mutations in Tpte
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Tpte APN 8 22320882 missense probably benign 0.03
IGL01456:Tpte APN 8 22345052 splice site probably benign
IGL01947:Tpte APN 8 22355473 missense possibly damaging 0.88
IGL01975:Tpte APN 8 22349337 missense probably damaging 1.00
IGL02458:Tpte APN 8 22305858 missense probably benign
IGL03411:Tpte APN 8 22325537 missense possibly damaging 0.64
R0158:Tpte UTSW 8 22327739 missense possibly damaging 0.47
R0396:Tpte UTSW 8 22335608 splice site probably benign
R0611:Tpte UTSW 8 22336533 missense possibly damaging 0.68
R1481:Tpte UTSW 8 22355471 missense probably damaging 1.00
R1489:Tpte UTSW 8 22349389 critical splice donor site probably null
R1569:Tpte UTSW 8 22345031 missense probably damaging 0.98
R1632:Tpte UTSW 8 22349347 missense probably damaging 0.98
R1639:Tpte UTSW 8 22320897 missense probably benign 0.00
R2030:Tpte UTSW 8 22345885 missense probably damaging 1.00
R2057:Tpte UTSW 8 22318339 missense probably benign 0.13
R2519:Tpte UTSW 8 22333160 splice site probably benign
R2655:Tpte UTSW 8 22311278 critical splice acceptor site probably null
R2884:Tpte UTSW 8 22335423 nonsense probably null
R3734:Tpte UTSW 8 22359482 missense probably damaging 1.00
R3961:Tpte UTSW 8 22359415 missense probably damaging 0.99
R4050:Tpte UTSW 8 22365984 missense probably damaging 1.00
R4591:Tpte UTSW 8 22327775 missense probably benign 0.08
R4994:Tpte UTSW 8 22318346 missense probably benign 0.23
R5321:Tpte UTSW 8 22297203 nonsense probably null
R5394:Tpte UTSW 8 22327790 missense probably damaging 1.00
R5588:Tpte UTSW 8 22284967 missense possibly damaging 0.95
R5590:Tpte UTSW 8 22351452 missense probably damaging 1.00
R5670:Tpte UTSW 8 22327748 missense probably damaging 1.00
R6544:Tpte UTSW 8 22315105 critical splice donor site probably null
R6596:Tpte UTSW 8 22333269 missense probably damaging 0.99
R6729:Tpte UTSW 8 22355475 missense probably damaging 1.00
R7120:Tpte UTSW 8 22327673 missense probably damaging 1.00
R7526:Tpte UTSW 8 22325547 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCGGGGAAAGAGTTTTCTG -3'
(R):5'- CCAGTATAGGGGAATTCCAGGACC -3'

Sequencing Primer
(F):5'- CCGGGGAAAGAGTTTTCTGAAAAATG -3'
(R):5'- TTCCAGGACCAGGAAGCAG -3'
Posted On2015-02-05