Incidental Mutation 'R3154:Dnajb3'
ID263383
Institutional Source Beutler Lab
Gene Symbol Dnajb3
Ensembl Gene ENSMUSG00000081984
Gene NameDnaJ heat shock protein family (Hsp40) member B3
SynonymsMSJ-1, Hsj3, Msj1
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location88204732-88205782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88205051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 210 (V210F)
Ref Sequence ENSEMBL: ENSMUSP00000112703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000119972] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049289
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119972
AA Change: V210F

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112703
Gene: ENSMUSG00000081984
AA Change: V210F

DomainStartEndE-ValueType
DnaJ 2 61 6.22e-33 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Dnajb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Dnajb3 APN 1 88205382 missense probably benign 0.00
IGL02489:Dnajb3 APN 1 88205310 missense probably benign 0.37
IGL02726:Dnajb3 APN 1 88205650 missense probably damaging 1.00
IGL02733:Dnajb3 APN 1 88204940 intron probably benign
IGL02867:Dnajb3 APN 1 88205527 missense probably benign 0.43
R1235:Dnajb3 UTSW 1 88205479 missense probably benign 0.03
R4232:Dnajb3 UTSW 1 88205252 missense possibly damaging 0.75
R4718:Dnajb3 UTSW 1 88205339 missense probably benign 0.13
R5033:Dnajb3 UTSW 1 88205023 missense possibly damaging 0.94
R6393:Dnajb3 UTSW 1 88205662 missense possibly damaging 0.64
R6980:Dnajb3 UTSW 1 88205014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAAGAGGCACCGACATG -3'
(R):5'- CTTTACCGAATTCCCAGGATTTG -3'

Sequencing Primer
(F):5'- CGACATGAGCTGCATATAATGTCTGG -3'
(R):5'- CCAGGATTTGGGGGTGGC -3'
Posted On2015-02-05