Incidental Mutation 'R3154:Cobll1'
ID263386
Institutional Source Beutler Lab
Gene Symbol Cobll1
Ensembl Gene ENSMUSG00000034903
Gene NameCobl-like 1
SynonymsD430044D16Rik, Coblr1
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location65088339-65239403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65107050 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 406 (M406K)
Ref Sequence ENSEMBL: ENSMUSP00000088412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431]
Predicted Effect probably benign
Transcript: ENSMUST00000090896
AA Change: M406K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: M406K

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 1.3e-38 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 1023 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102726
AA Change: M406K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: M406K

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1060 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112429
AA Change: M406K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: M406K

DomainStartEndE-ValueType
Pfam:Cobl 148 239 5.4e-49 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112430
AA Change: M405K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: M405K

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
Pfam:Cobl 185 263 1.3e-38 PFAM
low complexity region 331 342 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112431
AA Change: M406K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: M406K

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155768
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Cobll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cobll1 APN 2 65126013 missense probably damaging 1.00
IGL01074:Cobll1 APN 2 65107848 missense probably damaging 1.00
IGL01093:Cobll1 APN 2 65098237 missense probably damaging 1.00
IGL02411:Cobll1 APN 2 65097740 missense probably damaging 1.00
IGL02419:Cobll1 APN 2 65151048 missense probably damaging 1.00
IGL02550:Cobll1 APN 2 65107863 missense probably damaging 1.00
IGL02607:Cobll1 APN 2 65151085 missense probably damaging 0.98
IGL02829:Cobll1 APN 2 65126045 missense probably damaging 1.00
IGL02802:Cobll1 UTSW 2 65098319 missense probably damaging 0.99
R0313:Cobll1 UTSW 2 65095744 nonsense probably null
R0314:Cobll1 UTSW 2 65089521 missense possibly damaging 0.81
R0322:Cobll1 UTSW 2 65102098 missense possibly damaging 0.84
R0846:Cobll1 UTSW 2 65102065 splice site probably null
R1163:Cobll1 UTSW 2 65098279 missense probably damaging 0.96
R1242:Cobll1 UTSW 2 65151169 critical splice acceptor site probably null
R1364:Cobll1 UTSW 2 65126310 splice site probably benign
R1445:Cobll1 UTSW 2 65099136 missense probably damaging 1.00
R1610:Cobll1 UTSW 2 65133642 missense probably damaging 1.00
R1836:Cobll1 UTSW 2 65126236 missense probably damaging 1.00
R2102:Cobll1 UTSW 2 65098210 missense probably damaging 1.00
R4580:Cobll1 UTSW 2 65151073 missense probably benign 0.00
R4638:Cobll1 UTSW 2 65099237 missense probably benign 0.03
R4684:Cobll1 UTSW 2 65099028 missense possibly damaging 0.90
R4906:Cobll1 UTSW 2 65097693 missense probably benign 0.01
R4923:Cobll1 UTSW 2 65099258 missense possibly damaging 0.87
R5100:Cobll1 UTSW 2 65125901 missense probably benign 0.26
R5269:Cobll1 UTSW 2 65133771 nonsense probably null
R5419:Cobll1 UTSW 2 65103357 missense possibly damaging 0.57
R5637:Cobll1 UTSW 2 65125903 missense possibly damaging 0.90
R5745:Cobll1 UTSW 2 65098457 missense probably damaging 0.99
R5777:Cobll1 UTSW 2 65103268 missense probably benign 0.27
R6303:Cobll1 UTSW 2 65098033 missense possibly damaging 0.68
R6471:Cobll1 UTSW 2 65107884 missense probably damaging 1.00
X0020:Cobll1 UTSW 2 65103322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGAAAATGTGATTTCTGCCAG -3'
(R):5'- CACCGCCATTCCATGATTGAC -3'

Sequencing Primer
(F):5'- AATGTGATTTCTGCCAGTTTCTTATC -3'
(R):5'- CGCCATTCCATGATTGACTACATAGG -3'
Posted On2015-02-05