Incidental Mutation 'R3154:Styk1'
ID263400
Institutional Source Beutler Lab
Gene Symbol Styk1
Ensembl Gene ENSMUSG00000032899
Gene Nameserine/threonine/tyrosine kinase 1
Synonyms
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131299142-131353597 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 131310012 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 84 (Y84*)
Ref Sequence ENSEMBL: ENSMUSP00000112900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049150] [ENSMUST00000121078]
Predicted Effect probably null
Transcript: ENSMUST00000049150
AA Change: Y173*
SMART Domains Protein: ENSMUSP00000044098
Gene: ENSMUSG00000032899
AA Change: Y173*

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Pkinase 119 387 3.2e-31 PFAM
Pfam:Pkinase_Tyr 119 387 1.8e-59 PFAM
low complexity region 399 410 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121078
AA Change: Y84*
SMART Domains Protein: ENSMUSP00000112900
Gene: ENSMUSG00000032899
AA Change: Y84*

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 298 2.5e-53 PFAM
Pfam:Pkinase 68 298 5.7e-29 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135859
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor protein tyrosine kinases, like STYK1, play important roles in diverse cellular and developmental processes, such as cell proliferation, differentiation, and survival (Liu et al., 2004 [PubMed 15150103]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 G T 13: 24,956,163 probably null Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Styk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Styk1 APN 6 131301662 missense possibly damaging 0.75
IGL01370:Styk1 APN 6 131301652 missense probably damaging 1.00
IGL01833:Styk1 APN 6 131302366 splice site probably benign
IGL02705:Styk1 APN 6 131312583 missense probably benign 0.02
IGL03029:Styk1 APN 6 131300560 missense probably benign 0.27
conviction UTSW 6 131312576 missense probably benign 0.01
will UTSW 6 131312917 critical splice donor site probably null
R0201:Styk1 UTSW 6 131301730 splice site probably benign
R2267:Styk1 UTSW 6 131312576 missense probably benign 0.01
R2268:Styk1 UTSW 6 131312576 missense probably benign 0.01
R2269:Styk1 UTSW 6 131312576 missense probably benign 0.01
R2919:Styk1 UTSW 6 131313004 start gained probably benign
R3153:Styk1 UTSW 6 131310012 nonsense probably null
R4041:Styk1 UTSW 6 131312917 critical splice donor site probably null
R4650:Styk1 UTSW 6 131300569 missense probably damaging 1.00
R4739:Styk1 UTSW 6 131300466 missense probably damaging 1.00
R5079:Styk1 UTSW 6 131301713 missense probably damaging 1.00
R5497:Styk1 UTSW 6 131304707 missense probably damaging 0.97
R5637:Styk1 UTSW 6 131300418 missense possibly damaging 0.82
R6137:Styk1 UTSW 6 131311016 missense probably damaging 1.00
R6429:Styk1 UTSW 6 131310064 missense possibly damaging 0.93
X0021:Styk1 UTSW 6 131307069 critical splice donor site probably null
X0026:Styk1 UTSW 6 131310939 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACGTGTGAAACACTAACCAAAG -3'
(R):5'- AGCATTACTGTCTTCTAGGTGGTC -3'

Sequencing Primer
(F):5'- CAAAGCTTTTCCTTACTAGTGTAGC -3'
(R):5'- AGGTGGTCCTCCCTTCTG -3'
Posted On2015-02-05