Incidental Mutation 'R3154:Disc1'
ID263406
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Namedisrupted in schizophrenia 1
Synonyms
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125054195-125261858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125135304 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 472 (S472T)
Ref Sequence ENSEMBL: ENSMUSP00000112929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953]
Predicted Effect probably damaging
Transcript: ENSMUST00000074562
AA Change: S474T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: S474T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075730
AA Change: S474T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: S474T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098311
AA Change: S474T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: S474T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115885
AA Change: S474T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: S474T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117658
AA Change: S474T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: S474T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118942
AA Change: S474T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: S474T

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121953
AA Change: S472T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: S472T

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125088275 missense probably benign 0.27
IGL01319:Disc1 APN 8 125087891 missense probably damaging 0.99
IGL02001:Disc1 APN 8 125251042 missense probably damaging 0.97
IGL02403:Disc1 APN 8 125135519 splice site probably benign
IGL02445:Disc1 APN 8 125148403 splice site probably benign
R0334:Disc1 UTSW 8 125261097 synonymous probably null
R0992:Disc1 UTSW 8 125088042 missense probably damaging 1.00
R1654:Disc1 UTSW 8 125148465 missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125124610 missense probably benign 0.05
R3947:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3948:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3949:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R4051:Disc1 UTSW 8 125148425 missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125148459 missense probably damaging 1.00
R4691:Disc1 UTSW 8 125148447 missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125124538 missense probably damaging 1.00
R4825:Disc1 UTSW 8 125135302 missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125124550 nonsense probably null
R5087:Disc1 UTSW 8 125132160 missense probably benign
R5383:Disc1 UTSW 8 125135457 missense probably damaging 1.00
R5827:Disc1 UTSW 8 125135365 missense probably damaging 1.00
R5828:Disc1 UTSW 8 125251024 missense probably damaging 0.99
R6431:Disc1 UTSW 8 125135389 missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125218105 missense probably benign 0.00
R6794:Disc1 UTSW 8 125087775 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAGCAAACTTCTGGAATCTGCC -3'
(R):5'- AAAGTCACCAGTACCTCCTGAG -3'

Sequencing Primer
(F):5'- AATCTGCCTGCCTCGGAAG -3'
(R):5'- ACCTGGAAGGGAGCCTG -3'
Posted On2015-02-05