Incidental Mutation 'R3154:Rgl3'
ID263409
Institutional Source Beutler Lab
Gene Symbol Rgl3
Ensembl Gene ENSMUSG00000040146
Gene Nameral guanine nucleotide dissociation stimulator-like 3
Synonyms1300003D20Rik
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21968711-21989446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21980774 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 338 (L338P)
Ref Sequence ENSEMBL: ENSMUSP00000148965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045726] [ENSMUST00000214026] [ENSMUST00000215851]
Predicted Effect probably damaging
Transcript: ENSMUST00000045726
AA Change: L338P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146
AA Change: L338P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213130
Predicted Effect probably damaging
Transcript: ENSMUST00000214026
AA Change: L338P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect probably benign
Transcript: ENSMUST00000215851
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Rgl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rgl3 APN 9 21977239 missense probably damaging 1.00
IGL00770:Rgl3 APN 9 21987722 splice site probably benign
IGL00774:Rgl3 APN 9 21987722 splice site probably benign
IGL02071:Rgl3 APN 9 21988263 missense probably benign 0.00
IGL02172:Rgl3 APN 9 21976838 missense probably damaging 1.00
IGL02190:Rgl3 APN 9 21981708 missense probably benign 0.00
IGL02277:Rgl3 APN 9 21974109 missense probably damaging 1.00
IGL02515:Rgl3 APN 9 21974100 missense possibly damaging 0.93
R0077:Rgl3 UTSW 9 21974102 missense probably benign 0.00
R0126:Rgl3 UTSW 9 21975812 missense probably benign 0.06
R0360:Rgl3 UTSW 9 21976857 missense probably damaging 0.97
R0421:Rgl3 UTSW 9 21976032 missense probably benign 0.06
R0556:Rgl3 UTSW 9 21975844 nonsense probably null
R0751:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1184:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1548:Rgl3 UTSW 9 21980706 missense probably benign 0.11
R2176:Rgl3 UTSW 9 21975958 utr 3 prime probably benign
R3607:Rgl3 UTSW 9 21987691 missense probably damaging 0.98
R3803:Rgl3 UTSW 9 21976025 missense probably damaging 1.00
R3958:Rgl3 UTSW 9 21975589 intron probably benign
R4081:Rgl3 UTSW 9 21987675 missense possibly damaging 0.79
R4937:Rgl3 UTSW 9 21987708 nonsense probably null
R5068:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5070:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5217:Rgl3 UTSW 9 21987648 makesense probably null
R5772:Rgl3 UTSW 9 21981612 missense probably benign 0.00
R5819:Rgl3 UTSW 9 21981602 critical splice donor site probably null
R6509:Rgl3 UTSW 9 21971908 missense probably benign 0.00
R7425:Rgl3 UTSW 9 21976827 nonsense probably null
X0019:Rgl3 UTSW 9 21981479 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAAACAGACAGCGGTTCCC -3'
(R):5'- CTGACCTGGTATCAGAAAATCCAAC -3'

Sequencing Primer
(F):5'- AACAGACAGCGGTTCCCTGTAG -3'
(R):5'- CCTGGGTATAGAGGCACATACCTG -3'
Posted On2015-02-05