Incidental Mutation 'R3154:Zfp759'
ID263424
Institutional Source Beutler Lab
Gene Symbol Zfp759
Ensembl Gene ENSMUSG00000057396
Gene Namezinc finger protein 759
SynonymsRslcan-8
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67121660-67141787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67138655 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000153653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052716] [ENSMUST00000224346]
Predicted Effect probably benign
Transcript: ENSMUST00000052716
AA Change: E90G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049650
Gene: ENSMUSG00000057396
AA Change: E90G

DomainStartEndE-ValueType
KRAB 5 65 1.6e-22 SMART
ZnF_C2H2 106 128 5.54e1 SMART
ZnF_C2H2 162 184 3.83e-2 SMART
ZnF_C2H2 190 212 1.82e-3 SMART
ZnF_C2H2 218 240 1.64e-1 SMART
ZnF_C2H2 246 268 1.67e-2 SMART
ZnF_C2H2 274 296 1.95e-3 SMART
ZnF_C2H2 302 324 1.84e-4 SMART
ZnF_C2H2 330 352 7.78e-3 SMART
ZnF_C2H2 358 380 1.6e-4 SMART
ZnF_C2H2 386 408 1.67e-2 SMART
ZnF_C2H2 414 436 4.87e-4 SMART
ZnF_C2H2 442 464 3.39e-3 SMART
ZnF_C2H2 498 520 2.57e-3 SMART
ZnF_C2H2 526 548 8.47e-4 SMART
ZnF_C2H2 554 576 2.02e-1 SMART
ZnF_C2H2 582 604 2.53e-2 SMART
ZnF_C2H2 610 632 4.79e-3 SMART
ZnF_C2H2 638 660 1.84e-4 SMART
ZnF_C2H2 666 688 1.36e-2 SMART
ZnF_C2H2 694 716 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224346
AA Change: E96G

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224426
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Zfp759
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Zfp759 APN 13 67139594 missense probably benign 0.25
IGL03131:Zfp759 APN 13 67138664 missense probably damaging 1.00
IGL03218:Zfp759 APN 13 67139416 missense probably benign 0.00
R0243:Zfp759 UTSW 13 67138813 missense possibly damaging 0.66
R0319:Zfp759 UTSW 13 67140292 missense probably benign 0.00
R0520:Zfp759 UTSW 13 67137355 missense probably benign 0.29
R0961:Zfp759 UTSW 13 67139863 missense probably benign 0.32
R1435:Zfp759 UTSW 13 67138766 missense possibly damaging 0.73
R1649:Zfp759 UTSW 13 67139604 missense probably benign 0.00
R1880:Zfp759 UTSW 13 67139212 missense probably damaging 1.00
R2118:Zfp759 UTSW 13 67139514 unclassified probably benign
R2170:Zfp759 UTSW 13 67136748 missense possibly damaging 0.88
R3551:Zfp759 UTSW 13 67138967 missense probably benign 0.24
R4392:Zfp759 UTSW 13 67139643 nonsense probably null
R4495:Zfp759 UTSW 13 67138925 unclassified probably null
R4736:Zfp759 UTSW 13 67139344 missense probably damaging 1.00
R4882:Zfp759 UTSW 13 67139290 missense probably damaging 1.00
R5717:Zfp759 UTSW 13 67138708 missense probably damaging 1.00
R5921:Zfp759 UTSW 13 67140494 missense probably damaging 1.00
R6247:Zfp759 UTSW 13 67140460 missense probably benign 0.00
R6381:Zfp759 UTSW 13 67138905 nonsense probably null
R6427:Zfp759 UTSW 13 67139098 unclassified probably null
R6567:Zfp759 UTSW 13 67139086 missense probably benign 0.34
R7140:Zfp759 UTSW 13 67140113 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTTTCTTCAAGGGAGTCTACATG -3'
(R):5'- GGAACATGGAAGGCCTTGCTAC -3'

Sequencing Primer
(F):5'- CAAGGGAGTCTACATGATTTTCAC -3'
(R):5'- GGAAGGCCTTGCTACATGTTTCATAC -3'
Posted On2015-02-05