Incidental Mutation 'R3155:Stk4'
ID263447
Institutional Source Beutler Lab
Gene Symbol Stk4
Ensembl Gene ENSMUSG00000018209
Gene Nameserine/threonine kinase 4
SynonymsYsk3, sterile 20-like kinase 1, Kas-2, Mst1
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164070322-164155524 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164151743 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 98 (M98K)
Ref Sequence ENSEMBL: ENSMUSP00000085629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018353] [ENSMUST00000088291]
Predicted Effect probably benign
Transcript: ENSMUST00000018353
AA Change: M459K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209
AA Change: M459K

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088291
AA Change: M98K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000085629
Gene: ENSMUSG00000018209
AA Change: M98K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:Mst1_SARAH 71 119 3e-30 PFAM
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Stk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
hallon UTSW 2 164099827 critical splice donor site probably null
iwo_jima UTSW 2 164088959 missense possibly damaging 0.94
ribeye UTSW 2 164079566 missense probably damaging 1.00
sergeant UTSW 2 164099712 missense probably benign
stryker UTSW 2 164083688 nonsense probably null
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1972:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5088:Stk4 UTSW 2 164083688 nonsense probably null
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
R7453:Stk4 UTSW 2 164086602 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAACAGCTCTGTGGTTGTG -3'
(R):5'- TTCACAAAGGTGCTGTGGAG -3'

Sequencing Primer
(F):5'- GGTCATTGGAATTAGCTCTTGC -3'
(R):5'- TCACAAAGGTGCTGTGGAGAGATG -3'
Posted On2015-02-05