Incidental Mutation 'R3155:Rusc1'
ID263448
Institutional Source Beutler Lab
Gene Symbol Rusc1
Ensembl Gene ENSMUSG00000041263
Gene NameRUN and SH3 domain containing 1
Synonyms
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89083981-89093311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89091731 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 248 (D248G)
Ref Sequence ENSEMBL: ENSMUSP00000088447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052539] [ENSMUST00000081848] [ENSMUST00000090929] [ENSMUST00000166687] [ENSMUST00000196043] [ENSMUST00000196223] [ENSMUST00000196254] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]
Predicted Effect probably benign
Transcript: ENSMUST00000052539
AA Change: D248G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056640
Gene: ENSMUSG00000041263
AA Change: D248G

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
RUN 589 657 2.75e-16 SMART
low complexity region 669 683 N/A INTRINSIC
low complexity region 702 714 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
SH3 838 893 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081848
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090929
AA Change: D248G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000088447
Gene: ENSMUSG00000041263
AA Change: D248G

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
internal_repeat_1 195 244 5.11e-5 PROSPERO
internal_repeat_1 247 292 5.11e-5 PROSPERO
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 463 479 N/A INTRINSIC
low complexity region 522 543 N/A INTRINSIC
low complexity region 546 584 N/A INTRINSIC
low complexity region 714 725 N/A INTRINSIC
RUN 726 794 2.75e-16 SMART
low complexity region 806 820 N/A INTRINSIC
low complexity region 839 851 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
SH3 975 1030 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166687
SMART Domains Protein: ENSMUSP00000130477
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
low complexity region 115 126 N/A INTRINSIC
RUN 127 195 2.75e-16 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
SH3 376 431 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196043
SMART Domains Protein: ENSMUSP00000142622
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
PDB:4GIW|B 8 79 5e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196223
SMART Domains Protein: ENSMUSP00000143662
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
Pfam:RUN 61 166 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196254
SMART Domains Protein: ENSMUSP00000142669
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 1 238 3.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196709
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196921
SMART Domains Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 226 7.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198506
Predicted Effect probably benign
Transcript: ENSMUST00000199668
SMART Domains Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 121 3.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200433
Predicted Effect probably benign
Transcript: ENSMUST00000200659
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Meta Mutation Damage Score 0.0512 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Rusc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Rusc1 APN 3 89092421 missense probably damaging 0.99
IGL02795:Rusc1 APN 3 89091950 missense probably damaging 1.00
IGL03174:Rusc1 APN 3 89091770 missense probably damaging 1.00
R0422:Rusc1 UTSW 3 89086825 missense probably benign 0.01
R1711:Rusc1 UTSW 3 89089293 missense probably damaging 1.00
R1846:Rusc1 UTSW 3 89092145 missense probably damaging 1.00
R2060:Rusc1 UTSW 3 89087848 missense possibly damaging 0.86
R2114:Rusc1 UTSW 3 89091707 missense probably benign
R2209:Rusc1 UTSW 3 89088821 missense probably damaging 1.00
R3081:Rusc1 UTSW 3 89091723 missense possibly damaging 0.84
R3156:Rusc1 UTSW 3 89091731 missense probably benign 0.03
R4499:Rusc1 UTSW 3 89092308 missense probably benign 0.02
R4678:Rusc1 UTSW 3 89089720 missense probably damaging 1.00
R4725:Rusc1 UTSW 3 89091429 missense possibly damaging 0.83
R4762:Rusc1 UTSW 3 89091642 missense probably benign
R4890:Rusc1 UTSW 3 89088270 critical splice acceptor site probably null
R5176:Rusc1 UTSW 3 89089082 missense probably damaging 1.00
R5783:Rusc1 UTSW 3 89088145 missense probably damaging 1.00
R5910:Rusc1 UTSW 3 89091720 missense probably benign 0.05
R6189:Rusc1 UTSW 3 89089012 missense probably damaging 1.00
R6190:Rusc1 UTSW 3 89091881 missense probably benign
R6227:Rusc1 UTSW 3 89091741 missense probably benign 0.06
R7087:Rusc1 UTSW 3 89089492 missense probably damaging 0.96
R7184:Rusc1 UTSW 3 89091887 missense possibly damaging 0.61
R7237:Rusc1 UTSW 3 89091498 missense possibly damaging 0.66
R7343:Rusc1 UTSW 3 89091750 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATGGAAGGACGTGATTGTC -3'
(R):5'- ACCTGGACTCGAACTGCAAC -3'

Sequencing Primer
(F):5'- ACGTGATTGTCCGATGGGGC -3'
(R):5'- TCGAACTGCAACGCCCTG -3'
Posted On2015-02-05