Incidental Mutation 'R3155:Slc15a4'
ID263457
Institutional Source Beutler Lab
Gene Symbol Slc15a4
Ensembl Gene ENSMUSG00000029416
Gene Namesolute carrier family 15, member 4
SynonymsPHT1, C130069N12Rik, PTR4
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location127595664-127632897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127604536 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031367] [ENSMUST00000152727] [ENSMUST00000152727] [ENSMUST00000153832] [ENSMUST00000155321]
Predicted Effect probably null
Transcript: ENSMUST00000031367
SMART Domains Protein: ENSMUSP00000031367
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Pfam:MFS_1 33 505 7.8e-13 PFAM
Pfam:PTR2 96 519 3.6e-127 PFAM
transmembrane domain 533 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124569
SMART Domains Protein: ENSMUSP00000121595
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PTR2 49 242 8.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144603
SMART Domains Protein: ENSMUSP00000116420
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 127 2.2e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153832
SMART Domains Protein: ENSMUSP00000123116
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Pfam:PTR2 96 292 5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155321
SMART Domains Protein: ENSMUSP00000117258
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 105 1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200212
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation display abrogation of both Toll-like receptor (TLR)-induced type I IFN and proinflammatory cytokine production by plasmacytoid dendritic cells. Conventional dendritic cells respond normally to TLR ligands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Slc15a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc15a4 APN 5 127601960 missense probably benign 0.13
IGL01543:Slc15a4 APN 5 127603766 missense probably benign 0.12
IGL01805:Slc15a4 APN 5 127608836 missense possibly damaging 0.91
IGL02958:Slc15a4 APN 5 127604665 missense possibly damaging 0.93
IGL03367:Slc15a4 APN 5 127601941 missense probably damaging 1.00
feeble UTSW 5 127608770 unclassified probably benign
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0838:Slc15a4 UTSW 5 127617003 missense possibly damaging 0.53
R1544:Slc15a4 UTSW 5 127603768 missense probably benign 0.01
R1662:Slc15a4 UTSW 5 127608979 missense probably damaging 1.00
R2504:Slc15a4 UTSW 5 127617239 missense possibly damaging 0.92
R2843:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2845:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2846:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2900:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2971:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3018:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3020:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3021:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3027:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3053:Slc15a4 UTSW 5 127596682 missense possibly damaging 0.83
R3432:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4356:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4357:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4359:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4448:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4449:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4450:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4514:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4544:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4546:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4952:Slc15a4 UTSW 5 127603837 missense probably damaging 1.00
R5278:Slc15a4 UTSW 5 127616969 missense probably damaging 0.99
R6393:Slc15a4 UTSW 5 127616886 missense probably benign 0.13
R6527:Slc15a4 UTSW 5 127596709 missense probably damaging 1.00
R7409:Slc15a4 UTSW 5 127604678 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCTTCCAGGCACCCAAATG -3'
(R):5'- CAGAGCATTGTCACTAGGGGTG -3'

Sequencing Primer
(F):5'- TTCCAGGCACCCAAATGACAAAG -3'
(R):5'- TGTTTCCCAAAGTGAAGGCC -3'
Posted On2015-02-05