Incidental Mutation 'R3155:Zfp324'
ID263458
Institutional Source Beutler Lab
Gene Symbol Zfp324
Ensembl Gene ENSMUSG00000004500
Gene Namezinc finger protein 324
SynonymsD430030K24Rik, ZF5128
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12965838-12974236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12968890 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 60 (M60I)
Ref Sequence ENSEMBL: ENSMUSP00000124620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000124387] [ENSMUST00000128293] [ENSMUST00000210619]
Predicted Effect probably damaging
Transcript: ENSMUST00000038701
AA Change: M60I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500
AA Change: M60I

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Predicted Effect probably damaging
Transcript: ENSMUST00000128293
AA Change: M60I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500
AA Change: M60I

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210619
AA Change: M60I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Other mutations in Zfp324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Zfp324 APN 7 12969435 missense probably benign 0.02
IGL01943:Zfp324 APN 7 12968786 splice site probably benign
IGL02668:Zfp324 APN 7 12970846 missense probably damaging 1.00
R0883:Zfp324 UTSW 7 12971024 missense probably damaging 1.00
R0931:Zfp324 UTSW 7 12966258 missense probably benign 0.05
R1164:Zfp324 UTSW 7 12971624 missense probably benign 0.02
R1587:Zfp324 UTSW 7 12970643 missense possibly damaging 0.63
R1837:Zfp324 UTSW 7 12970229 missense probably benign 0.15
R1982:Zfp324 UTSW 7 12971218 missense probably damaging 1.00
R2333:Zfp324 UTSW 7 12971245 missense possibly damaging 0.93
R4050:Zfp324 UTSW 7 12970867 missense probably damaging 1.00
R4784:Zfp324 UTSW 7 12971306 missense probably damaging 1.00
R4992:Zfp324 UTSW 7 12969373 missense probably benign 0.02
R5970:Zfp324 UTSW 7 12969366 missense probably benign 0.28
R6767:Zfp324 UTSW 7 12970600 missense probably null 0.13
R7007:Zfp324 UTSW 7 12971215 missense probably damaging 1.00
R7152:Zfp324 UTSW 7 12966271 missense probably benign 0.07
R7164:Zfp324 UTSW 7 12968883 missense probably damaging 0.97
R7233:Zfp324 UTSW 7 12970597 nonsense probably null
X0062:Zfp324 UTSW 7 12971389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATCTCCATTAATAGGGAACAGG -3'
(R):5'- CCCCAGGGATACAGGAAATG -3'

Sequencing Primer
(F):5'- GGTTCCTACCTCACTCAGCCATC -3'
(R):5'- TCAGACTATATGTGTCCAGGGCAC -3'
Posted On2015-02-05