Incidental Mutation 'R0324:Kntc1'
ID26346
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123778112 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 701 (K701N)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably damaging
Transcript: ENSMUST00000031366
AA Change: K701N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: K701N

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197665
Predicted Effect probably benign
Transcript: ENSMUST00000198841
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
R7381:Kntc1 UTSW 5 123810908 missense probably benign 0.12
R7485:Kntc1 UTSW 5 123786956 missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123790938 missense probably damaging 1.00
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCACTGGTAATCGTGGTCATAACTG -3'
(R):5'- AGCACTGAACATGCAGAGGCAC -3'

Sequencing Primer
(F):5'- GGTAATCGTGGTCATAACTGATTTC -3'
(R):5'- cctccaagcctgacgac -3'
Posted On2013-04-16