Incidental Mutation 'R3155:Urgcp'
ID263467
Institutional Source Beutler Lab
Gene Symbol Urgcp
Ensembl Gene ENSMUSG00000049680
Gene Nameupregulator of cell proliferation
Synonyms
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5713417-5762376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5716327 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 670 (F670L)
Ref Sequence ENSEMBL: ENSMUSP00000133216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053427] [ENSMUST00000093362] [ENSMUST00000118076] [ENSMUST00000120306] [ENSMUST00000140922] [ENSMUST00000170116]
Predicted Effect probably damaging
Transcript: ENSMUST00000053427
AA Change: F670L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055821
Gene: ENSMUSG00000049680
AA Change: F670L

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093362
AA Change: F713L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091053
Gene: ENSMUSG00000049680
AA Change: F713L

DomainStartEndE-ValueType
Blast:PGAM 15 752 N/A BLAST
SCOP:d1h65a_ 670 761 1e-3 SMART
coiled coil region 899 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118076
AA Change: F670L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113589
Gene: ENSMUSG00000049680
AA Change: F670L

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120306
AA Change: F670L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113060
Gene: ENSMUSG00000049680
AA Change: F670L

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140922
SMART Domains Protein: ENSMUSP00000120902
Gene: ENSMUSG00000049680

DomainStartEndE-ValueType
Blast:PGAM 1 99 7e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149980
Predicted Effect probably damaging
Transcript: ENSMUST00000170116
AA Change: F670L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133216
Gene: ENSMUSG00000049680
AA Change: F670L

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] URG4 is upregulated in the presence of hepatitis B virus (HBV)-encoded X antigen (HBxAg) and may contribute to the development of hepatocellular carcinoma by promoting hepatocellular growth and survival (Tufan et al., 2002 [PubMed 12082552]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Urgcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Urgcp APN 11 5716448 missense possibly damaging 0.94
IGL01832:Urgcp APN 11 5717325 missense probably damaging 0.99
IGL02299:Urgcp APN 11 5717573 missense probably damaging 1.00
IGL02519:Urgcp APN 11 5717745 missense probably benign 0.02
IGL02616:Urgcp APN 11 5717400 missense probably damaging 0.99
IGL02619:Urgcp APN 11 5715752 missense possibly damaging 0.87
IGL03135:Urgcp APN 11 5716091 missense possibly damaging 0.79
IGL03209:Urgcp APN 11 5717238 unclassified probably null
PIT4305001:Urgcp UTSW 11 5717996 missense probably damaging 1.00
R0279:Urgcp UTSW 11 5716989 missense probably benign 0.14
R0555:Urgcp UTSW 11 5717477 missense probably damaging 1.00
R1110:Urgcp UTSW 11 5716004 missense probably benign 0.09
R1595:Urgcp UTSW 11 5717447 missense probably damaging 1.00
R1808:Urgcp UTSW 11 5717242 missense probably damaging 1.00
R1891:Urgcp UTSW 11 5716910 missense probably benign 0.43
R1993:Urgcp UTSW 11 5716526 missense probably damaging 1.00
R3769:Urgcp UTSW 11 5717000 missense probably damaging 1.00
R4209:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R4210:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R4211:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R5335:Urgcp UTSW 11 5717754 missense possibly damaging 0.66
R6242:Urgcp UTSW 11 5716691 missense probably benign 0.34
R6971:Urgcp UTSW 11 5718115 missense probably benign 0.34
R7411:Urgcp UTSW 11 5718116 missense probably benign 0.10
R7460:Urgcp UTSW 11 5716622 missense possibly damaging 0.88
X0005:Urgcp UTSW 11 5718231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACCTGTCTCCAGCAGAG -3'
(R):5'- CCAGTTCTATGAAGCGGAGAG -3'

Sequencing Primer
(F):5'- TCTCCAGCAGAGGCCAAG -3'
(R):5'- AGAGCTGCCTGATCGAGG -3'
Posted On2015-02-05