Incidental Mutation 'R3155:Rbp3'
ID263474
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33957114 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1006 (K1006N)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: K1006N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: K1006N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.0392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGCTGATAACTATGCATCCCC -3'
(R):5'- TATAGAGCTGCCCAGAGACAG -3'

Sequencing Primer
(F):5'- AACTATGCATCCCCTGAATTGGG -3'
(R):5'- CTGCCCAGAGACAGTGGAGAC -3'
Posted On2015-02-05