Incidental Mutation 'R3155:Olfr726'
ID263475
Institutional Source Beutler Lab
Gene Symbol Olfr726
Ensembl Gene ENSMUSG00000060523
Gene Nameolfactory receptor 726
SynonymsMOR246-4, GA_x6K02T2PMLR-5775299-5774334
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50083570-50090953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50084525 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000149373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072370] [ENSMUST00000206834] [ENSMUST00000213345] [ENSMUST00000215105] [ENSMUST00000215278] [ENSMUST00000217025] [ENSMUST00000217319] [ENSMUST00000217422]
Predicted Effect probably benign
Transcript: ENSMUST00000072370
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072207
Gene: ENSMUSG00000060523
AA Change: D52G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 288 5.4e-8 PFAM
Pfam:7tm_1 41 287 7.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205951
AA Change: D52G
Predicted Effect probably benign
Transcript: ENSMUST00000206834
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213345
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215105
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215278
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000217025
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000217319
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000217422
AA Change: D52G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Olfr726
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr726 APN 14 50083997 missense probably benign 0.00
IGL01432:Olfr726 APN 14 50083947 missense probably benign 0.07
IGL01788:Olfr726 APN 14 50084502 missense probably damaging 1.00
IGL01957:Olfr726 APN 14 50084280 missense probably benign 0.00
IGL02132:Olfr726 APN 14 50084486 missense probably damaging 1.00
R0611:Olfr726 UTSW 14 50083853 missense probably damaging 1.00
R0689:Olfr726 UTSW 14 50084232 missense probably benign 0.01
R1556:Olfr726 UTSW 14 50084459 missense possibly damaging 0.90
R1710:Olfr726 UTSW 14 50084370 missense probably benign 0.01
R1791:Olfr726 UTSW 14 50084042 missense probably benign 0.03
R1804:Olfr726 UTSW 14 50083902 missense probably damaging 0.99
R1853:Olfr726 UTSW 14 50084120 missense probably damaging 1.00
R2034:Olfr726 UTSW 14 50083983 missense probably benign 0.34
R3156:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3939:Olfr726 UTSW 14 50083716 makesense probably null
R4392:Olfr726 UTSW 14 50084603 missense probably benign 0.24
R4533:Olfr726 UTSW 14 50083699 unclassified probably null
R4694:Olfr726 UTSW 14 50084019 missense probably benign
R5183:Olfr726 UTSW 14 50084546 missense probably damaging 0.99
R5859:Olfr726 UTSW 14 50084027 missense probably damaging 1.00
R6186:Olfr726 UTSW 14 50084525 missense probably damaging 0.98
R6357:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6771:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6834:Olfr726 UTSW 14 50084228 missense probably damaging 0.99
R6924:Olfr726 UTSW 14 50083850 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCGATCATAGGCCATGGATAC -3'
(R):5'- TCAGATAACTGAAGGCAACTCTC -3'

Sequencing Primer
(F):5'- CATTTCACCACCAGCAAATTGATG -3'
(R):5'- GGCAACTCTCTTCCAAGTCAATG -3'
Posted On2015-02-05