Incidental Mutation 'R3155:H2-Eb1'
ID263479
Institutional Source Beutler Lab
Gene Symbol H2-Eb1
Ensembl Gene ENSMUSG00000060586
Gene Namehistocompatibility 2, class II antigen E beta
SynonymsH-2Eb, Ia-4, Ia4
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34305877-34316199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34314374 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 190 (T190K)
Ref Sequence ENSEMBL: ENSMUSP00000074143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074557]
Predicted Effect probably damaging
Transcript: ENSMUST00000074557
AA Change: T190K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074143
Gene: ENSMUSG00000060586
AA Change: T190K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_beta 40 114 4.64e-47 SMART
IGc1 139 210 2.24e-24 SMART
transmembrane domain 226 248 N/A INTRINSIC
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in H2-Eb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0724:H2-Eb1 UTSW 17 34315032 splice site probably benign
R0763:H2-Eb1 UTSW 17 34314159 splice site probably benign
R2029:H2-Eb1 UTSW 17 34314392 missense probably damaging 1.00
R3440:H2-Eb1 UTSW 17 34309681 missense probably damaging 1.00
R4050:H2-Eb1 UTSW 17 34314368 missense probably damaging 1.00
R4084:H2-Eb1 UTSW 17 34314443 missense probably damaging 0.98
R5605:H2-Eb1 UTSW 17 34309833 missense probably benign 0.09
R5667:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5671:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5851:H2-Eb1 UTSW 17 34309771 missense probably benign 0.13
R6951:H2-Eb1 UTSW 17 34309857 nonsense probably null
R7387:H2-Eb1 UTSW 17 34314233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTACGGTGACTGTGTAC -3'
(R):5'- ACCCTGTAAGCCATGGTGAAAG -3'

Sequencing Primer
(F):5'- TACGGTGACTGTGTACCCCAC -3'
(R):5'- CCATGGTGAAAGGCAGGAC -3'
Posted On2015-02-05